The capsule polysaccharide of strains was extracted and quantified as previously described21 (link),50 (link). Briefly, 1 × 109 colony forming units (CFU) bacteria were pelleted for capsule uronic acid extraction. Bacteria were mixed with 1% Zwittergent 3–14 detergent (Sangon Biotech, catalogue number A610552) in 100 mM citric acid (Sangon Biotech, catalogue number A610055). Then uronic acid was precipitated by ethanol (Sinopharm Chemical Reagent, catalogue number 10009218), incubated with 0.0125 M sodium tetraborate/sulfuric acid (tetraborate, Sigma-Aldrich, catalogue number 221732; sulfuric acid, Sinopharm Chemical Reagent, catalogue number 10021608) and 0.125% carbazole absolute ethanol (carbazole, Sangon Biotech, catalogue number A600269), finally measured at 530 nm and correlated to a standard curve of d -glucuronic acid.
Citric acid
Manufactured by Sangon
Sourced in China
Citric acid is a chemical compound that is commonly used in various laboratory applications. It is a crystalline solid that is soluble in water and has a tart, acidic taste. Citric acid is a naturally occurring substance that is found in many fruits, particularly citrus fruits. It is widely used as a pH regulator, flavoring agent, and preservative in a variety of industries, including food, beverage, and pharmaceutical production.
Automatically generated - may contain errors
Lab products found in correlation
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Sulfuric acid, by Sinopharm (1 mentions)
Sucrose, by Sangon (1 mentions)
Fructose, by Sangon (1 mentions)
Type 7170a, by Hitachi (1 mentions)
Trisodium citrate, by Sangon (1 mentions)
Indole 3 acetic acid, by Sangon (1 mentions)
Sodium dodecyl sulfate (sds), by Merck Group (1 mentions)
Urea, by Merck Group (1 mentions)
Ammonium bicarbonate, by Merck Group (1 mentions)
Trypsin, by Promega (1 mentions)
Hplc grade acetonitrile acn, by J&K Scientific (1 mentions)
Folin ciocalteu s phenol reagent, by Sangon (1 mentions)
2 2 diphenyl 1 picrylhydrazyl (dpph), by Merck Group (1 mentions)
Tris hcl, by Sangon (1 mentions)
Millipore q purification system, by Merck Group (1 mentions)
Glycine, by Sinopharm (1 mentions)
Sodium hydroxide (naoh), by Sangon (1 mentions)
Vanillin, by Sangon (1 mentions)
Propidine iodide pi, by Solarbio (1 mentions)
8 protocols using citric acid
1
Capsule Polysaccharide Quantification
2
Shushanggan Apricot Fruit Harvest and Storage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
‘Shushanggan apricot’ fruits were harvested in the experimental plot located at Sanyuan, Shaanxi Province, China (34.5414° N, 108.8328° E). The young apricot fruits, born in the same inflorescence and with the consistent florescence were selected to be registered and marked (Figure 5 ). During the 2021 harvest season (from the 26 March to 14 June), the immature green (G), color-changing (CC I and CC II) and full mature (M) fruits were collected, and the fruit color could be distinguished at 29, 65, 72 and 81 days after flowering (DAF), respectively.
The fresh fruits, with uniform size, color and maturity, and without mechanical damage, were washed with distilled water, immediately put into liquid nitrogen and stored at −80 °C in the ultra-low temperature freezer for further use.
Chemical standards (fructose, glucose, sucrose, malic acid and citric acid) were purchased from Sangon Biotech (Shanghai) Co., Ltd.(Shanghai, China). Other reagents are analytically pure, purchased from Sinopharm Chemical Reagent Shanghai Co., Ltd.
The fresh fruits, with uniform size, color and maturity, and without mechanical damage, were washed with distilled water, immediately put into liquid nitrogen and stored at −80 °C in the ultra-low temperature freezer for further use.
Chemical standards (fructose, glucose, sucrose, malic acid and citric acid) were purchased from Sangon Biotech (Shanghai) Co., Ltd.(Shanghai, China). Other reagents are analytically pure, purchased from Sinopharm Chemical Reagent Shanghai Co., Ltd.
3
Blood Lipid Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Venous blood samples of 5 ml were drawn after at least 12 h of fasting. A total of 2 ml of the sample was collected into a glass tube and used to determine serum lipid levels. The remaining 3 ml was transferred to tubes with anticoagulants (4.80 g/l citric acid, 14.70 g/l glucose and 13.20 g/l trisodium citrate; Shanghai Sangon Biological Engineering Technology & Services Co.) and used to extract DNA. Measurements of serum TC, TG, HDL-C and LDL-C levels in the samples were performed using enzymatic methods with a Ransod autoanalyzer (Randox Laboratories Ltd., Crumlin, UK and Daiichi Pure Chemicals Co., Ltd., Tokyo, Japan). Serum ApoA1 and ApoB levels were detected using the immunoturbidimetric immunoassay using a commercial kit (Randox Laboratories Ltd.). All determinations were performed with an autoanalyzer (Type 7170A; Hitachi Ltd., Tokyo, Japan) in the Clinical Science Experiment Center of the First Affiliated Hospital, Guangxi Medical University (27 (link)–30 (link)).
4
Indole-3-acetic acid metabolic analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Indole-3-acetic acid (IAA) and citric acid were purchased from Sangon Biotech (Shanghai, China). Methanol, formic acid, acetonitrile (ACN), indole, and isatin were purchased from Aladdin (Shanghai, China). Methoxyamine hydrochloride (MEOX), anthranilate, sodium dodecyl sulfate (SDS), ammonium bicarbonate, and urea were purchased from Sigma-Aldrich (Shanghai, China). N,O-Bis(trimethylsilyl)trifluoroacetamide (BSTFA) with 1% trimethylchlorosilane (TMCS) was purchased from Supelco (Shanghai, China). Trypsin was purchased from Promega Corporation (WI, United States). All other reagents used in this study were of liquid chromatography–mass spectrometry (LC-MS) or chromatographically grade and commercially available. The mineral salt medium (MSM) used in this study was prepared according to the previous description (Yu et al., 2018b ). IAA and IAA analogs were added into MSM before autoclaving, and these compounds were stable after autoclaving. E. coli cells were cultivated in LB broth at 37°C as previously described (Yu et al., 2018b ).
5
Antioxidant Compound Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard compounds (chlorogenic acid, schisandrin, Schisantherin A, deoxyschizandrin, and γ-schizandrin) were all purchased from the National Institute for the Control of Pharmaceutical (Beijing, China) and Biological Products of China. 2,2-Diphenyl-1-picrylhydrazyl (DPPH) was purchased from Sigma (Shanghai, China). HPLC-grade acetonitrile (ACN) was from J & K Scientific (Tianjin, China). Tris-HCl, citric acid, and Folin-Ciocalteu’s phenol reagent were purchased from Sango Biotech (Shanghai, China) Co. Ltd. Phosphoric acid, sodium carbonate, calcium carbonate, and 95% ethanol were of analytical grade and were ordered from Shandong Yuwang Chemical Company (Dezhou, China).
6
Preparation of Analytical Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Citric acid, NaOH, vanillin, d -(−)-salicin and glutathione were purchased from Sangon Biotech (Shanghai, China) Co., Ltd. Glucose and glycine were obtained from Sinopharm Group Chemical Reagent Co., Ltd (Shanghai, China). Sucrose was purchased from Shanghai Chemical Reagents Co., Ltd (Shanghai, China). Sodium dihydrogen phosphate dihydrate (NaH2PO4·2H2O), disodium hydrogen phosphate dodecahydrate (Na2HPO4·12H2O) and potassium hydrogen phosphate (K2HPO4·3H2O) were bought from Tianjin Kemeiou Chemical Reagent Co., Ltd (Tianjin, China). Ascorbic acid was obtained from Shanghai Tri-Four Hewei Chemical Co., Ltd (Shanghai, China). Quinine sulfate was obtained from Tianjin Heowns Biochem Co., Ltd (Tianjin, China). All chemicals were of analytical grade and the water was distilled and passed through a Millipore Q purification system (Millipore Corporation).
7
Semen Cryopreservation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tris, glucose, citric acid and glycerol were purchased from Sangon Biotech (Shanghai, China). Penicillin–streptomycin was purchased from Thermo Fisher (Waltham, Massachusetts, USA). The freezing extender I contained Tris base 300.48 mM, glucose 27.75 mM, citric acid 94.72 mM and Penicillin–streptomycin 200 IU/mL with 20% egg yolk. The freezing extender II contained 94% freezing extender I and 6% glycerol. Peanut agglutinin conjugated with fluorescein isothiocyanate (FITC‐PNA) was purchased from Sigma (St Louis, MO, USA). Propidine iodide (PI) was purchased from Solarbio (Beijing, China). ROS assay kit was purchased from Beyotime (Shanghai, China).
8
Colorimetric Bioassay for Streptavidin Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA oligonucleotides were synthesized and purified by Sangon Inc. (Shanghai, China). Their sequences are listed in Table 1 . Streptavidin, bovine serum albumin (BSA), SYBR Green I (SG I), TMB, citric acid, disodium hydrogen phosphate, TE buffer, 0.1 M PBS buffer, 2 × SSC hybridization buffer and transparent ELISA plate were also purchased from Sangon Inc. (Shanghai, China). Colorimetric bioassay was carried out on a PHOMO Automatic enzyme immunoassay analyzer (Zhengzhou Antu Instruments Co. Ltd., China)
Oligonucleotides used in the present work.
| Oligonucleotides | Sequences (5′-3′) |
|---|---|
| SA aptamer: | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC |
| Capture probe: | bio-TTTTTGTTGTAGCAC |
| detection probe P1: | CTCATGGAGAGAGAATTTGGGTGCGAGACGTGCTACAA |
| detection probe P2: | CAGCGATCAGTTCAACTCTCTCCATGAG |
| detection probe P3: | GTCTCGCACCCAAAGAACTGATCGCTG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!