The coding sequences of the PG9, PGT128, VRC01 bN-mAbs were obtained from published sequences (available from the NIH AIDS Reagent Program, Germantown, MD) and used to created synthetic genes for stable or transient expression of antibodies in CHO cells. Antibodies were purified using Protein G chromatography. These cell lines have been deposited in the NIH AIDS Reagent Program. The 10–1074 bN-mAb was acquired from the NIH AIDS Reagent Program. The 34.1 mAb to the Herpes Simplex Virus glycoprotein D (gD) was produced in-house [39 (link)]. The human 447-52D mAb was contributed by Dr. Susan Zolla-Pazner (Mount Sinai, New York City, NY). Recombinant rgp120s were cloned with an N-terminal gD tag into a pCF vector [39 (link)]. Plasmids were transformed in 5-alpha competent E. coli cells (New England Biolabs, Ipswich, MA), purified using Plasmid Maxi Kit (Qiagen, Hilden, Germany) and electroporated into CHO cells as described below. Recombinant human factor VIII consisted of Advate (Baxter Healthcare Corporation, Deerfield, Illinois) [40 (link)], and was acquired by the laboratory of Dr. Peter Lollar (Emory University, Atlanta, GA).
5 alpha competent e coli cells
Manufactured by New England Biolabs
Sourced in United States
5-alpha competent E. coli cells are a strain of Escherichia coli bacteria that have been made competent for the purpose of DNA transformation. They are commonly used in molecular biology and genetic engineering applications.
Automatically generated - may contain errors
Lab products found in correlation
Plasmid maxi kit, by Qiagen (1 mentions)
Advate, by Baxter (1 mentions)
Chloramphenicol, by GoldBio (1 mentions)
Cyan adp flow cytometer, by Beckman Coulter (1 mentions)
Orf clone in cloning vector, by Sino Biological (1 mentions)
Pgem t easy vector system, by Promega (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
4 protocols using 5 alpha competent e coli cells
1
Recombinant Antibody Production Protocol
2
Cloning and Expression of TBP6.7 β2-β3 Loop Peptide
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The β2–β3-loop peptide sequence of TBP6.7 (Figure 4A ) was cloned into the pB33eCPX construct (41 (link)) (AddGene) using restriction enzymes NdeI and XhoI (NEB), downstream of an in-frame myc tag and transformed into 5-alpha competent E. coli cells (NEB). The eCPX-β2–β3-loop plasmid DNA was purified by miniprep (Omega) and ∼200 ng were used to electroporate E. coli MC1061 F− cells (Lucigen) in 1 mm electroporation cuvettes (Fisher). Cells were grown in 50 ml LB (Fisher) containing 12.5 μg ml−1 chloramphenicol (GoldBio Technology) at 37 °C to an OD600 of 0.5 and induced overnight with 0.1% arabinose at 25 °C. ∼5 × 108 cells were pelleted (7300 × g) for 5 min at 4 °C, then washed with ice-cold CellGro PBS 1× (Corning). Cells were incubated with 100 nM Cy5-labeled TAR RNA (IDT) (annealed by heating at 95 °C for 2 min, followed by plunging into ice) and 1:1000-fold diluted FITC-conjugated anti-cMyc antibody (Abcam) with rotating at 4 °C in 1 ml PBS for 1 h. Cells were pelleted and washed once with ice-cold PBS. RNA-binding (Cy5 fluorescence) and display (FITC fluorescence) were measured using a CyAn ADP flow cytometer (Beckman-Coulter). All flow data were analyzed and plotted using FlowJo 10.3.
3
B7.1 Overexpression in EO771 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse B7-1 cDNA ORF Clone in Cloning Vector (SinoBiological, Beijing, China, Cat. #MG50446-G) was transfected into 5-alpha Competent E. coli cells (NEB, Ipswich, MA, USA, Cat. #C2987H), following manufacturer’s protocol. Colony PCR for B7.1 using the following primers: 5′ACGTACAGATCTATGGCTTGCAATTGTCAGTTGATG′3, 5′CATGCAGTCGACCTAAAGGAAGACGGTCTGTTCAGC′3 was performed to identify bacteria with the correct plasmid. All plasmids were verified by sequencing. B7.1 was ligated into the destination vector MSCV-IRES-Thy1.1 DEST (pMIT) (Addgene, Watertown, MA, USA, Cat. #17442). pMIT-B7.1 was transfected into Platinum E cells using Lipofectamine3000. Viral supernatant was collected and used to transduce EO771 cells. EO771-B7.1 expressing cells were selected for double positive Thy1.1/B7.1 expression by fluorescence-activated cell sorting (FACS) to avoid selecting for specific antigenic changes.
4
Cloning and Sequencing of lscβ and lscγ
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding regions of lscβ and lscγ sequences and ~100 bp of 5′ and 3′ noncoding sequences were PCR-amplified from lysed cells of Psa3 KL103 using primers reported in Table S1. PCR products were purified from agarose gel troughs QIAquick Gel Extraction Kit (QIAGEN) and then cloned in pGEM-T vector using the pGEM®-T Easy Vector Systems (PROMEGA) following the manufacture instructions. Finally, plasmids were used to transform the 5-alpha competent E. coli cells (New England BioLabs) and colonies were selected with blue/white screening and standard ampicillin selection. Correct DNA insertion was checked by sequencing using primers T7/SP6.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!