The total RNA was extracted from cultured cells after 24 h incubation with various concentrations of IL-6 or IL-6/IL-8 using a High Pure RNA Isolation kit (Roche, Basel, Switzerland), according to manufacture's protocol. The extracted RNA was purified and diluted in DNase and RNase-free water. The quality and quantity of isolated RNA was measured using a spectrophotometer NanoDrop® (Thermo Fisher Scientific, Inc.). Reverse-transcriptase PCR was performed using High-Capacity cDNA Reverse Transcriptase (Thermo Fisher Scientific, Inc.). The quantitys of used RNA was 2,000 ng in a final volume of 20 µl. Subsequently, 1 µl of the resulting cDNA solution (100 ng) was used in qPCR, using primers and probes specific for complement factor H (CFH) and CFHR1. TagMan® Gene Expression assays (Thermo Fisher Scientific, Inc.) including specific primers and probes were purchased from Thermo Fisher Scientific, Inc. (Assay ID, CFH-Hs00962373_m1 and CFHR1-Hs00275663_m1). The relative expression was calculated using the 2−ΔΔCq method (17 (link)). β-actin mRNA was used as an endogenous control to normalize CFH and CFHR1 input.
High capacity cdna reverse transcriptase
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The High-capacity cDNA Reverse Transcriptase is a laboratory equipment designed for the synthesis of first-strand cDNA from RNA templates. It is a highly efficient and thermostable enzyme that catalyzes the reverse transcription process, which is a crucial step in various molecular biology applications, such as gene expression analysis and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Icycler, by Bio-Rad (3 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Myiq2 real time pcr system, by Bio-Rad (2 mentions)
Sybr green dye, by Bio-Rad (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Bio-Rad (2 mentions)
Cfx96 detection system, by Bio-Rad (2 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (2 mentions)
High pure rna isolation kit, by Roche (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Direct zol rna miniprep plus, by Zymo Research (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
2019 ncov n positive control, by Integrated DNA Technologies (1 mentions)
Qiaamp viral rna extraction kit, by Qiagen (1 mentions)
26 protocols using high capacity cdna reverse transcriptase
1
Quantifying CFH and CFHR1 Gene Expression
2
Kidney Gene Expression Analysis in Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat kidneys were immediately removed after euthanasia and cortical samples were dissected and frozen in liquid nitrogen and stored at −80°C for later analysis. RNA isolation and cDNA synthesis were performed according to manufacturer instructions using the Direct-zol RNA MiniPrep Plus (Zymo) and High-Capacity cDNA Reverse Transcriptase (Thermo Fisher Scientific) kits, respectively. Gene expression of Kruppel-like factor 2 (KLF2), endothelial nitric oxide synthase (eNOS), Nuclear factor erythroid 2-related factor 2 (NRF2), NAD(P)H quinone dehydrogenase 1 (NQO1), Kruppel-like Factor 15 (KLF15), E Cadherin, Kruppel-like Factor 4 (KLF4), and connective tissue growth factor (CTGF) was assessed by Sso Advanced SYBR green chemistry (Bio-Rad) real-time PCR following reverse transcription of total RNA. Real-time PCR was performed on a CFX Connect Real Time PCR Detection System (Bio-Rad, Hercules, CA). β-Actin mRNA was quantified as an internal control for each sample and quantifications were performed using the ΔΔCt method and expressed as fold change (f.c.). Forward and Reverse primer sequences are show in Table 2 .
3
Quantifying Inflammatory Cytokine Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole skin was homogenized and processed for extraction and isolation of RNA, using TRIzol reagents (Thermo Fisher), following the manufacturer’s instructions. RNA was quantified using a standard Nanodrop, and cDNA was obtained using high-capacity cDNA reverse transcriptase (Thermo Fisher). Quantitative PCR on cDNA was performed using TaqMan gene expression master mix and TaqMan gene expression assays for Il17, Il6, Cxcl1, Cxcl2, Il10, Ifng, and Gapdh (Thermo Fisher) on a StepOnePlus real-time PCR system (Applied Biosystems), according to the manufacturers’ instructions. Log2-transformed fold change of transcripts was calculated from threshold cycle (ΔΔCT) values relative to Gapdh expression, normalized for the PBS mock control.
4
SARS-CoV-2 RNA Detection in Organotypic Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was isolated from organotypic cultures using the QIAamp viral RNA extraction kit (Qiagen, Verlo, The Netherlands) following manufacturer’s instructions and quantified using a Nanodrop™ (ThermoFisher Scientific). Total RNA from organotypic slices were isolated using the RNeasy mini kit (Qiagen) and quantified using the Nanodrop. cDNA was generated using the high-capacity cDNA reverse transcriptase (ThermoFisher Scientific). Real-time PCR was carried out using the Taqpath reagent (ThermoFisher Scientific) and the primers/probes recommended by the US CDC SARS-CoV-2 RUO qPCR Primer & Probe Kit for N1 (catalog #10006713, Integrated DNA Technologies) with 2019-nCoV_N_Positive Control (catalog #10006625, Integrated DNA Technologies).
5
Real-time PCR of ∆K280 Tau Aggregation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
∆K280 TauRD-DsRed SH-SY5Y cells were seeded in a 6-well plate (5×105/well), differentiated with retinoic acid, and treated with congo red, SB-415286, VB-030 or VB-037 (10 µM) and doxycycline as described. On day 8, cells were collected and total RNA was extracted using Trizol reagent (Invitrogen). The RNA was reverse-transcribed using high-capacity cDNA reverse transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). Real-time quantitative PCR experiments were performed using 100 ng cDNA and customized Assays-by-Design probe for DsRed and HPRT1 (4326321E) using StepOnePlus Real-time PCR system (Applied Biosystems, Foster City, CA, USA). Fold change was calculated using the formula 2∆Ct, ∆CT=CT (HPRT1)–CT (DsRed), in which CT indicates cycle threshold.
6
Confirming Phf6 Knockout Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm that Phf6 cKO does not express Phf6 mRNA, we isolated mRNA from bone marrow of 3 Ctrl and 3 cKO animals using TRizol (Thermo Scientific, #15596026) and prepared cDNA using 500 ng of total RNA using high capacity cDNA reverse transcriptase (Thermo Scientific, #4368813). qPCR for Phf6 was carried out using primers TGTTTTCGTCTGCTTTGGTG (forward) and ATCATGCAATGCACAGTGGT (reverse), and for Gapdh (endogenous control) using primers CCCAGCTTAGGTTCATCAGG (forward) and GAATTTGCCGTGAGTGGAGT (reverse).
7
Viral RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from all dilutions was extracted with a kit specific for viral RNA (QiaAmp Viral RNA Mini Kit; Qiagen, Valencia, CA, USA) according to the manufacturer's protocol. A sample of only serum was also extracted as a negative control. cDNA was synthesized with a high-capacity reverse transcriptase (High-Capacity cDNA Reverse Transcriptase; Thermo Fisher, Massachusetts, USA).
8
Quantitative Analysis of Hypothalamic and Pituitary Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from dessected hypothalami and pituitary glands from p140Cap KO and WT mice using Trizol Reagent (Ambion, Life Technologies Italia) and its concentration was determined with a NanoDrop™ 1100 (NanoDrop Technologies, Wilmington, DE, United States). Total RNA was reverse transcribed with high-capacity cDNA reverse transcriptase (#4368813, Applied BioSystem) according to the manufacturer’s instructions and amplified with specific primers. Taqman PCR reactions were performed using the Universal Probe Library system (Roche Italia, Monza, Italy) and quantified with the Molecular Analyst software (Bio-Rad Laboratories). The 18S rRNA pre-developed TaqMan assay (#4319413, Applied Biosystems) was used as an internal control. The expression of the target genes was calibrated against the values obtained in WT animals. Primers and probes used:
GnRH f 5′- CCCTTTGACTTTCACATCCAA-3′
GnRH r 5′- CGCAACCCATAGGACCAGT-3′ [probe #19]
LH f 5′- GTCCCAGGACTCAACCAATG-3′
LH r 5′- AACACCTGCTGGTGGTGAA-3′ [probe #10].
GnRH f 5′- CCCTTTGACTTTCACATCCAA-3′
GnRH r 5′- CGCAACCCATAGGACCAGT-3′ [probe #19]
LH f 5′- GTCCCAGGACTCAACCAATG-3′
LH r 5′- AACACCTGCTGGTGGTGAA-3′ [probe #10].
9
Quantifying Iron Transporter Expression in Caco-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA from Caco-2 (CacoReady) was isolated automatically using a Maxwell ® 16 (Promega) system and a kit for RNA extraction from tissue and mammal cells. The first strand of cDNA was obtained using high-capacity cDNA reverse transcriptase (Applied Biosystem). The cDNA was used as a template for polymerase chain reaction (PCR) amplification using TaqMan polymerase (Applied Biosystem). Commercial primers were used (Applied Biosystem): DMT1 (4331182), IREG1 (4331182) and β-actine (4326315). Data for DMT1 and IREG1 were normalized to levels of β-actin mRNA, a constitutively expressed gene. The quantification of gene expression is related with a reference condition by the following formula: 2 -▪ΔΔCt (ΔCt = (Ct biomarker gene -Ct internal gen (β-actin) and ΔΔCt (Δct sample -ΔCt reference).
10
Multiplex RT-PCR for Respiratory Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total nucleic acids were extracted from archived NPA using a NucliSENS easyMAG platform (bioMerieux), and eluted in a final volume of 60 µl of elution buffer [25] (link). RNA was reverse transcribed with High Capacity cDNA Reverse Transcriptase (Invitrogen, Life Technologies) and primed with oligo-dT primers (Invitrogen, Life Technologies). Real-time PCR was done in an ABI 7500 RT-PCR system (Applied Biosystems, Life Technologies), reactions were performed in 20 µl using TaqMan Universal PCR Master Mix (Applied Biosystems, Life Technologies) and the primers and probes listed in Table S1 .
Five duplex RT-PCR reactions, targeting the 8 respiratory viruses, were developed. Internal controls (the human genes: ribonucleoprotein and glyceraldehyde-3-phosphate dehydrogenase; or the spiked viruses: lambda and Newcastle Disease Virus) were included to check the efficiency of the extraction step and to detect the presence of PCR inhibitors. Positive controls were included in each experiment.
Five duplex RT-PCR reactions, targeting the 8 respiratory viruses, were developed. Internal controls (the human genes: ribonucleoprotein and glyceraldehyde-3-phosphate dehydrogenase; or the spiked viruses: lambda and Newcastle Disease Virus) were included to check the efficiency of the extraction step and to detect the presence of PCR inhibitors. Positive controls were included in each experiment.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!