Hiseq analysis software

For data analysis, FastQ files obtained after sequencing were demultiplexed using the HiSeq Analysis software (Illumina). sgRegnase-1 (GGAGTGGAAACGCTTCATCG) reads were removed, and single-end reads were trimmed and quality-filtered using the CLC Genomics Workbench v11 (Qiagen) and matched against sgRNA sequences from the genome-scale sgRNA Brie library. Read counts for sgRNAs were normalized against total read counts across all samples. For each sgRNA, the fold change (log₂ ratio) for enrichment was calculated between each of the biological replicates and the input experiment. Gene ranking was based on the average enrichment (log₂ ratio (TIL/input)) among replicates in representation of 4 individual corresponding sgRNAs in the genome-scale sgRNA Brie library. The gene level false discovery rate adjusted P-value was calculated among multiple sgRNAs (n = 4) of each gene, using a using a two-tailed paired Student’s t-test between log₂ transformed average normalized read counts of tumor samples and those of input sample, and the P-value was further adjusted using Bonferroni correction with gene size.

For data analysis, raw FASTQ files obtained after sequencing were demultiplexed using the HiSeq Analysis software (Illumina), as described (Wei et al., 2019 (link)). Single-end reads were trimmed and quality-filtered using the CLC Genomics Workbench v.11 (Qiagen) and matched against sgRNA sequences from the sgRNA metabolic library. Read counts for sgRNAs were normalized against total read counts across all samples. For each sgRNA, the fold change (FC; log₂-transformed ratio) for enrichment was calculated between each of the biological replicates and the input experiment. After merging the quantification results from two sub-libraries, the FC (log₂-transformed ratio) of genes was calculated on the basis of the average enrichment of their six gene-specific sgRNAs. The gene-level false-discovery-rate (FDR)-adjusted P value was calculated among multiple sgRNAs (n = 6) of each gene, using a two-tailed paired Student’s t-test between log₂-transformed average normalized read counts of MP samples and those of TE samples, between counts of MP samples and those of input sample, or between counts of TE samples and those of input sample. The P value was further adjusted using Bonferroni correction with gene size. The FC and P value of 1,000 negative control sgRNAs were calculated accordingly.

For data analysis, FastQ files obtained after sequencing were demultiplexed using the Hi-Seq Analysis software (Illumina). Single-end reads were trimmed and quality-filtered using the CLC Genomics Workbench v11 (Qiagen) and matched against sgRNA sequences from the sgRNA metabolic library. Read counts for sgRNAs were normalized against total read counts across all samples. For each sgRNA, the fold change (log₂ ratio) for enrichment was calculated between each of the biological replicates and the input experiment. Gene ranking was based on the average enrichment among replicates in representation of 6 individual corresponding sgRNAs (combining two sub-libraries) in sgRNA metabolic sub-libraries, respectively. The gene level false discovery rate (FDR) adjusted P value was calculated among multiple sgRNAs of each gene, using a paired two-tailed t-test between log₂ transformed average normalized read counts of Tfh cell (CXCR5⁺SLAM⁻), Th1 cell (CXCR5⁻SLAM⁺) or input cell samples, and a value of less than 0.05 was considered to be statistically significant.

For data analysis, raw FASTQ files obtained after sequencing were demultiplexed using the HiSeq Analysis software (Illumina). Single-end reads were trimmed and quality-filtered using the CLC Genomics Workbench v.11 (Qiagen) and matched against sgRNA sequences from the sgRNA epigenetic library. Read counts for sgRNAs were normalized against total read counts across all samples. For each sgRNA, the fold change (log₂-transformed ratio) for enrichment was calculated between each of the biological replicates and the input experiment. The gene-level false-discovery-rate (FDR)-adjusted p value was calculated among multiple sgRNAs (n=6) of each gene, using a two-tailed paired Student’s t-test between log₂-transformed average normalized read counts of MP samples and those of TE samples, between counts of total day 7.5 samples and those of total day 36 samples.