Lyec 12

2′3′-cGAMP was purchased from Invivogen. 2′3′-cGAMP (5 µg/ml) (Invivogen, tlrl-nacga23-02) was added to the cells complexed with LyoVec (Invivogen, Lyec-12) in order to aid internalization. ISD (Interferon stimulatory DNA)/LyoVec (Invitrogen, tlrl-isdc, 1 µg) was also used. Membrane lipid strips were obtained from Echelon. The following inhibitors were used: Fura-2 AM, Ca2+ selective fluorescent indicator (Abcam, ab120873), BX795 (TBK-1 inhibitor, Invivogen, tlrl-bx7, 1 µM), RU.521 (cGAS inhibitor, Invivogen, inh-ru521, 500 nM). GSK2998533 (100 nM) & GSK2683449 (100 nM) were provided by GlaxoSmithKline (GSK). PIK93 was also used (Sigma Aldrich, 1 µM)

A549 cells were transfected with 3p-hpRNA 5’ triphosphate hairpin RNA (VhpRNA, 5’pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC- 3’), a 89-mer synthesized from a sequence of influenza A H1N1 virus (Invivogen, 3p-hpRNA) using Lyovec reagent for transfection following the manufacturer’s protocol (Invivogen, lyec-12). After 3h, 6h and 24h cells were fixed in PFA 4% for immunofluorescence assays and supernatants were harvested for interferon beta (IFNβ) quantification. IFNβ measurement was performed using verikine-HS human IFN beta serum ELISA Kit (PBL assay science, 41415–1) following manufacturer’s instructions.