Prime 95b monochrome digital camera

Cells were plated onto 35-mm glass bottom dishes (Cellvis) 48 h before imaging and cells were stimulated by transfection of Cy5-labeled immunostimulatory DNA. Synthetic Cy5-labeled DNA was purified by HPLC (IDT) and consisted of the following duplexed 45 bp sequence: TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA, and transfected into MCF10A TREX1 knockout cells stably expressing GFP-TREX1 by Fugene HD (Promega) according to the manufacturer’s instructions. 1 h before imaging media was replaced with fresh medium. Live-cell imaging was performed at 37°C and 5% CO₂ using a Nikon Eclipse Ti2-E equipped with a CSU-W1 spinning disk with Borealis microadapter, Perfect Focus 4, motorized turret and encoded stage, polycarbonate thermal box, 5 line laser launch [405 (100 mw), 445 (45 mw), 488 (100 mw), 561 (80 mw), 640 (75 mw)], PRIME 95B Monochrome Digital Camera, and environmental enclosure (Tokai Hit) and CI Plan Apo Lambda 60x 1.40 NA. Images were acquired using NIS-Elements Advanced Research Software on a Dual Xeon Imaging workstation. Maximum intensity projection of z-stacks and adjustment of brightness and contrast were performed using FIJI software.

Cells were plated onto 35 mm glass bottom dishes (Cellvis) 48 h before imaging. Where indicated cells were treated overnight with Mps1i (reversine, 0.5 μM) to induce MN. ER tracker (Thermo Fisher Scientific) was used at a final concentration of 1μM and added directly before imaging. Live-cell imaging was performed at 37° C and 5% CO₂ using a Nikon Eclipse Ti2-E equipped with a CSU-W1 spinning disk with Borealis microadapter, Perfect Focus 4, motorized turret and encoded stage, polycarbonate thermal box, 5 line laser launch [405 (100 mw), 445 (45 mw), 488 (100 mw), 561 (80 mw), 640 (75 mw)], PRIME 95B Monochrome Digital Camera, and environmental enclosure (Tokai Hit). Objective lenses included CFI Plan Apo Lambda 40x 0.95 NA and CI Plan Apo Lambda 60x 1.40 NA. Images were acquired using NIS-Elements Advanced Research Software on a Dual Xeon Imaging workstation. Maximum intensity projection of z-stacks and adjustment of brightness and contrast were performed using Fiji software. Images were cropped and assembled into figures using Photoshop CS5.1 (Adobe).