The largest database of trusted experimental protocols

Fastgene scriptase 2 ready mix

Manufactured by Nippon Genetics
Sourced in Germany

FastGene Scriptase II Ready Mix is a pre-mixed solution for reverse transcription. It contains all the necessary components for converting RNA into cDNA, including reverse transcriptase, RNase inhibitor, and necessary buffers and reagents.

Automatically generated - may contain errors

2 protocols using fastgene scriptase 2 ready mix

1

Uterine Gene Expression Profiling in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
The expression of Pgr, HoxA10, integrin β3 (Itgb3), and Lif mRNA in uterine tissues (one-third of one horn for 3-month-old mice and half horn for 1-month-old mice) was determined by real-time PCR. According to the manufacturer’s instructions, RNA from individual mice was isolated using an RNeasy® mini kit (Qiagen). For each sample, 1 µg of RNA was converted to cDNA using the FastGene Scriptase II Ready Mix (Nippon Genetics, Düren, Germany). The quantitative RT-PCR was performed using SYBR Green PCR Master Mix and specific primers (Table 2) in a Fast Real-time PCR (QuantStudio 3, Thermo Fisher Scientific). Relative gene expression was analyzed according to the 2−ΔΔCt method. All samples were assayed in duplicate reactions. The Rplp0 and Gapdh genes were used as housekeeping genes to normalize the expression level, as Lin et al. advised for mouse uterus (Lin et al. 2013 (link)).

Primers for RT-qPCR.

Gene nameGenBank numberPrimer sequences (5′–3′)Product size (bp)
ForwardReverse
PgrNM_008829.2CTACTCGCTGTGCCTTACCATGCTGGCTTTGACTCCTCAGTCCT139
Hoxa10NM_008263.4GGCAGTTCCAAAGGCGAAAATGTCTGGTGCTTCGTGTAAGGC86
Itgb3NM_016780.2GGCGTTGTTGTTGGAGAGTCCTTCAGGTTACATCGGGGTCA138
LifNM_008501.3GCTGTATCGGATGGTCGCATACACAGACGGCAAAGCACATT156
GapdhNM_001289726.2GGTGGACCTCATGGCCTACACTCTCTTGATCAGTGTCCTTGCT82
Rplp0NM_007475.5GGACCCGAGAAGACCTCCTTGCACATCACTCAGAATTTCAATGG85
+ Open protocol
+ Expand
2

Quantification of HO-1 mRNA in Blood Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNA extraction blood samples were collected in Tempus Blood RNA Tubes (Applied Biosystems, Foster City, CA, USA) and stored at −80 °C. RNA was extracted according to the manufacturer’s instructions. The RNA concentration was determined for each sample prior to reverse transcription using NanoDrop One (ThermoScientific, Whaltham, MA 02451, USA). Reverse transcription reactions were performed using 4 µL of the 5× FastGene® Scriptase II ReadyMix (Nippon Genetics, Duren, Germany) and 100 ng of RNA for each reaction. Reactions were carried out in a CFX90 cycler (BioRad, Hercules, CA, USA) at the following conditions: 25 °C for 10 min, 42 °C for 60 min and 85 °C for 5 min. Real time PCR reactions were carried out in a CFX90 cycler. Each reaction consisted of 1 μL primer-probe assay mix (IDT, Coralville, IA, USA), 10 μL Luna Master Mix (Biolabs, Waltham, MA, USA) and 1 μL cDNA. The GAPDH was used as a housekeeping gene for data normalization. The sequences for the Real time PCR primers and probes for HO-1 mRNA were as follows: forward primer: 5′-GTT CCT CAT GAA CTC AGC ATT-3′, reverse primer: 5′-GAG CCA GCA CGA ACG AG-3′, probe: 56-FAM/AGC ATG CCC /ZEN/CAG GAT TTG TCA GA/3IABkFQ. Reactions were carried out in triplicate and results were analysed by the ΔΔCT method
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!