The largest database of trusted experimental protocols

Yp0250

Manufactured by Immunoway
Sourced in United States

YP0250 is a laboratory equipment used for centrifugation purposes. It has a maximum speed of 5,000 rpm and a maximum capacity of 50 ml. The device is designed for general laboratory use.

Automatically generated - may contain errors

2 protocols using yp0250

1

Western Blot Analysis of Cellular Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue or cellular protein was extracted using the RIPA lysis buffer (Beyotime, Shanghai, China), and the cytoplasmic and nuclear fractions were isolated by the extraction kit (P0027, Beyotime, Shanghai, China). The protein quantification was done with the BCA protein assay kit (Thermo Fisher Scientific, USA). The protein extracts were isolated with SDS‐PAGE gel (12%), which were subsequently transferred to the nitrocellulose membranes. The membranes were blocked for 1 h and incubated with following primary STAT3 (1:2000, 60199‐1‐Ig, Proteintech, USA), phospho‐STAT3 (1:1000, YP0250, Immunoway, USA), P65 (1:1000, 66535‐1‐Ig, Proteintech, USA), phospho‐P65 (1:1000, YP0847, Immunoway, USA), IκBα (1:1000, YM3718, Immunoway, USA), β‐catenin (1:1000, #8814, CST, USA), phospho‐β‐Catenin (1:1000, #4176, CST, USA), GSK3β (1: 5000, ab32391, Abcam, USA), Cyclin D1 (1:10000, ab134175, Abcam, USA), LEF‐1 (1:1000, ab131872, Abcam, USA), TCF‐1 (1:1000, #2203, CST, USA) antibodies overnight at 4°C and HRP‐labelled secondary antibodies (1:4000, Sigma, USA) for 2 h at room temperature. The ECL kit (Thermo Fisher Scientific, USA) was utilized to determine the immunoreactive bands, and the band densities were normalized to β‐actin (1:3000, cw0096, CWbiotech, China).
+ Open protocol
+ Expand
2

Circular RNA FISH Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the instructions, the fluorescence in situ hybridization (FISH) analysis was performed by the FISH Kit (F21201, Genepharma, Shanghai, China). Cy3‐labeled mmu_circ_0001109 (5′‐CACGCUGAACACAAUCUUGUUUCCUGGAUGCAGU‐3′) or mmu_circ_0001845 (5′AUUUGCUAGGAACCGGAACAAUCCCCAAAGGGAGC‐3′) probes were also designed and obtained from Shanghai GenePharma (China). After the slides were dewaxed, the probes were added into the hybridization solution and incubated with cells overnight in the dark at 37°C. Subsequently, slides were incubated with the following primary phospho‐STAT3 (1: 200, YP0250, Immunoway, USA), phospho‐P65 (1: 400, YP0847, Immunoway, USA) and β‐catenin (1: 400, #8814, CST, USA) for 2 h at 37°C. Then, slides were incubated with secondary antibody (BS50950, 1: 100, Bioworld, USA). Finally, the slides were counter stained with DAPI and imaged. The fluorescence intensity was calculated by the Image J software.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!