To remove neurons from cocultures, prewarmed PBS without Ca2+/Mg2+ (Thermo Fisher Scientific) was applied to the wells to wash the cells followed by a solution of 0.5 mM EDTA in PBS without Ca2+/Mg2+. Plates were incubated for a few minutes at 37°C and then observed under the microscope while gently rocking. Detached neurons were then removed, and wells were washed again with PBS without Ca2+/Mg2+. For RNA isolation, cells of 6 technical repeats were lysed in RNA isolation buffer containing 1% 2-mercaptoethanol (Thermo Fisher Scientific) and isolated with Quick-RNA MicroPrep according to the manufacturer’s protocol (Zymo Research). All samples were checked for RNA integrity number values greater than 9, and mRNA sequencing library was done according to protocol (Illumina). Libraries were sequenced on a NovaSeq S1 flowcell, SR100 mode, with 30 million reads per sample. Raw Fastq data were aligned against the human reference transcriptome hg38 using Salmon (71 (link)), and data analysis was performed with the R software package limma (72 (link)). For DEGs, only genes with 2-fold differences and below an adjusted P value of 0.01 were included. For pathway and Gene Ontology (GO) analysis, the web database Enrichr was used (70 (link)).
Quick rna microprep
Manufactured by Zymo Research
Sourced in United States, Germany
The Quick-RNA MicroPrep is a kit designed for the rapid isolation and purification of total RNA from small sample sizes, such as cells and tissue. The kit utilizes a spin-column format and provides a quick and efficient method for extracting high-quality RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (9 mentions)
Dnase, by Thermo Fisher Scientific (7 mentions)
Quick rna miniprep, by Zymo Research (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Iscript, by Bio-Rad (3 mentions)
Rneasy plus mini, by Qiagen (3 mentions)
Mastercycler realplex2 thermocycler, by Eppendorf (3 mentions)
Nanodrop lite, by Thermo Fisher Scientific (3 mentions)
Gotaq qpcr master mix, by Promega (3 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (3 mentions)
7900 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Tgfb1, by Thermo Fisher Scientific (2 mentions)
Sds 2, by Thermo Fisher Scientific (2 mentions)
Il 17a, by Thermo Fisher Scientific (2 mentions)
Primetime predesigned qpcr assay 6 fam zen ibfq, by Integrated DNA Technologies (2 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480 system, by Roche (2 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Optical 96 real time pcr thermal cycler, by Analytik Jena (2 mentions)
55 protocols using quick rna microprep
1
Neuron Isolation from Co-Cultures
2
Synthesis of mCherry-Trim21 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For in vitro transcription, plasmid pGEMHE-mCherry-mTrim21 (Addgene plasmid # 105522, was a gift by Melina Schuh) was linearized with SwaI (ThermoFisher, cat. no. FD1244). Capped mRNA was synthesized with T7 polymerase (Ambion mMessage mMachine T7 kit) according to manufacturer’s instructions. Obtained mCherry-Trim21 mRNA was purified with Quick-RNA MicroPrep (Zymo Research, cat. no. R1051) and preserved in MilliQ water at − 80 °C.
3
APOBEC Expression Profiling in Malaria Samples
4
Cloning and Sequencing Xenopus TRPV3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Xenopus tropicalis frogs were purchased from Xenopus Express, Inc. Quick-RNA MicroPrep (Zymo Research) was used for total RNA extraction. A small piece of skin of the frog was extracted from the legs and dissolved in the RNA lysis buffer. The tissue was homogenized and then centrifuged at a low speed to remove debris. The supernatant was transferred to a spin column (Zymo Research) for purification of RNA. The integrity of the resulting total RNA was tested on the basis of the quality of 28S and 18S rRNA bands on a 1% agarose gel. Reverse transcription from the eluded total RNA was performed with the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) according to the manufacturer’s protocol. About 2.5 µl of products was used for the PCR reaction, with primers designed to amplify the coding sequence of the TRPV3 transcript. The PCR product was subcloned into the pIRES2-EGFP expression vector (Invitrogen) and was verified by full-length sequencing.
5
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Quick-RNA™ MicroPrep (Zymo Research) following the manufacturer’s instructions and was reverse-transcribed on a GeneAmp® PCR System 9700 (Applied Biosystems). Real-time quantitative PCR reactions were performed on a 7900 HT FAST Realtime PCR System (Applied Biosystems). The cDNA equivalent of ~ 5 embryos per stage was used for each target gene. PrimeTime®Predesigned qPCR Assay (6-FAM/ZEN/IBFQ) from Integrated DNA Technologies was used. Assay IDs: Trim21: Mm.PT.5812570300 and β-Actin: Mm.PT.39a.22214843.g. All samples were processed as technical duplicates. Data were analyzed with the ΔΔCt method [73 (link)] using the Applied Biosystems RQ Manager (Version 1.2.2) and Microsoft Excel. ∆∆Ct = ∆ (Ct Trim21 - Ct β-Actin of mCherry-Trim21 injected embryos) – ∆ (Ct Trim21 - Ct β-Actin of non-injected wt embryos). Ct: cycle threshold.
6
Optimizing RNA sample storage protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To optimize sample storage, two different approaches were tested. On one side, RNA was extracted from the cells using the RNEasy Mini Kit (Qiagen) and then stored in RNAstable. On the other side, the cells were stored in RNAshield™ and subsequently, RNA was isolated using the Quick-RNA™ Micro Prep (Zymo Research). The concentration of RNA was measured with the NanoDrop™ 3300 Fluorospectrometer. To remove the remaining DNA, RNA was treated with DNAse (Ambion). RNA integrity was analysed using the Agilent Bioanalyzer 2100 System (Agilent technology).
7
Quantitative RT-PCR for TNC Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Quick-RNA MicroPrep (Zymo Research) and cDNA was generated using iScript (Bio-Rad). Quantitative real-time PCR (qRT-PCR) was performed using universal SYBR-Green Supermix (Bio-Rad) for designed primers. Analysis was performed in triplicate using the Light-Cycler 480 System (Roche Applied Science) and average Cp values were normalized relative to the housekeeping gene HPRT. The following primers were used:
TNC forward: 5′GCAGCTCCACACTCCAGGTA3′,
TNC reverse: 5′TTCAGCAGAATTGGGGATTT3′,
HPRT forward: 5′TGACACTGGCAAAACAATGCA3′, and.
HPRT reverse: 5′GGTCCTTTTCACCAGCAAGCT3′.
TNC forward: 5′GCAGCTCCACACTCCAGGTA3′,
TNC reverse: 5′TTCAGCAGAATTGGGGATTT3′,
HPRT forward: 5′TGACACTGGCAAAACAATGCA3′, and.
HPRT reverse: 5′GGTCCTTTTCACCAGCAAGCT3′.
8
Signal Transduction Pathways in Cytokine-Treated Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of 84 genes associated with ten different signal transduction pathways in neurons incubated with IL-17, TNFα, IFNγ, IL-17/ TNFα and IL-17/IFNγ was analyzed using the Human Signal Transduction PathwayFinder™ RT2 Profiler™ PCR Array (PAHS-014Z, Qiagen). Total RNA of two independent experiments containing 300,000–500,000 cells per condition and experiment was isolated with Quick-RNA™ MicroPrep (Zymo Research Europe) and isolated RNA was transcribed to cDNA using the RT2 First Strand Kit (Qiagen) according to the manufacturer’s protocol. RT2 Profiler™ PCR Array was performed with RT2 SYBR® Green qPCR Mastermix (Qiagen) according to the instructions using QuantStudio™ 5 Real-Time PCR System (Applied Biosystems). qPCR array data were normalization against five housekeeping genes (ACTB, B2M, HPRT1, GAPDH and RPLP0) and relative quantification (RQ) was calculated using the ΔΔCt-Method. R was used for data presentation as a heatmap. Please note: Expression of the following genes could not be analyzed due to a lack of expression either in control samples or in all samples: CA9 (hypoxia), FABP1 (PPAR), OLR1 (PPAR), BMP2 (hedgehog), WNT1 (hedgehog), WNT3A (hedgehog), WNT6 (hedgehog), SOCS3 (JAK-STAT), IRF1 (JAK-STAT), BCL2A (NFκB), BIRC3 (NFκB), IFNG (NFκB), TNF (NFκB), MMP7 (Wnt), WISP1 (Wnt).
9
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from skin tissue or cultured cells and extracted using the Quick-RNA MicroPrep (Zymo Research) according to the manufacturer’s instructions. In total, 1–2 μg of cDNA was synthesized using the high-capacity cDNA reverse transcription kit (Applied Biosystems), and real-time PCR was conducted using an Optical 96 real-time PCR thermal cycler (Biometra). Reactions were run in triplicate, samples were normalized to GAPDH expression, and quantities were determined according to the 2–ΔΔCt method. The primers used for quantitative PCR (qPCR) are listed in Supplemental Table 6 .
10
Comprehensive Gene Expression Analysis of APOBEC Family and Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the RNeasy Mini Kit (Qiagen, Hombrechtikon, Switzerland) and was subsequently treated with DNAse (Thermo Fisher Scientific) according to the manufacturer's protocol. For RNA isolation of cells derived from malaria patients and the corresponding controls, the Quick‐RNA Micro Prep (Zymo Research) was used as previously described [46 (link)]. A total of 1 μg RNA was reverse transcribed using the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). qRT‐PCR was performed using TaqMan Gene Expression Master Mix and primers and probes specific for the target genes: AICDA (Hs00757808_m1), APOBEC3A (Hs00377444_m1), APOBEC3B (Hs00358981_m1), APOBEC3C (Hs00819353_m1), APOBEC3D/E (Hs00537163_m1), APOBEC3F (Hs04184583_m1), APOBEC3G (Hs01043989_m1), APOBEC3H (Hs00419665_m1), IFNG (Hs00989291_m1), IL4 (Hs00174122_m1), IL10 (Hs00961622_m1), IL13 (Hs00174379_m1), IL17A (Hs00174383_m1), IL21 (Hs00222327_m1), TGFB1 (Hs00998133_m1), and for the housekeeping gene hydroxymethylbilane synthase (HMBS; Hs00609297_m1), all from Thermo Fisher Scientific. Samples were measured in technical triplicates with the 7900 Fast Real‐Time PCR System (Thermo Fisher Scientific). Data were analyzed using the SDS2.2 software (Applied Biosystems) and HMBS was used to normalize Ct values.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!