Rneasy mirneasy mini kit

Manufactured by Qiagen

Sourced in United States, Germany

The RNeasy/miRNeasy Mini kit is a set of laboratory equipment used for the purification of RNA from various biological samples. It is designed to isolate and extract high-quality RNA, including miRNA, from a wide range of sources such as cells, tissues, and body fluids.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using rneasy mirneasy mini kit

Characterizing miR-26a-5p Targets in Endometrial Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two online programs TargetScan and miRDB were used to predict potential target genes for miR-26a-5p.
GeneCards website (http://www.genecards.org) was used to identify relative regulators of endometrial cancer and lymphatic metastasis.
Quantitative real-time-PCR Total RNA was extracted from cell lines and human EC tissues using the TRIzol Reagent (Invitrogen, USA), and miRNA was extracted by the RNeasy/miRNeasy Mini kit (Qiagen). Reverse transcription was performed using PrimeScriptrt reagent kit (Qiagen), and the ABI Prism 7000 Sequence Detection System (ABI 7000 SDS) was used for real-time PCR analysis. U6 was used as the endogenous control of miRNAs, and GAPDH gene was used as an internal control for other mRNAs. Each experiment was repeated three times.

Wang J., Gong X., Yang L., Li L., Gao X., Ni T., Yang X., Fan Q., Cui Y., Sun X., & Wang Y. (2021). Downregulation of Exosomal miR-26a-5p Promotes Lymphangiogenesis and Lymphatic Metastasis in Endometrial Cancer.

+ Open protocol

+ Expand

Analyzing miRNA Expression in Chondrosarcoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miRNAs were isolated from chondrosarcoma tissues or cell lines using an RNeasy/miRNeasy Mini kit (Qiagen, Limburg, The Netherlands) according to the manufacturer’s instructions. Total RNA was isolated using the TRIzol reagent (Invitrogen). The cDNAs were synthesized using a RevertAidTM First Strand cDNA Synthesis kit (Fermentas, Vilnius, Lithuania), and real-time quantitative PCR was carried out using the SYBR-Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on a 7900 Real-Time PCR System (Applied Biosystems).
The primers used in this study were as follows: STAT3-F, 5′- CCCCATACCTGAAGACCAAG-3′and STAT3-R, 5′- GGACTCAAACTGCCCTCCT-3′; E-cadherin, CDH-1-F, 5′- TGCTCACATTTCCCAACTC-3′ and CDH-1-R, 5′-TCTGTCACCTTCAGCCATC-3’; N-cadherin, CDH-2-F, 5′- CTGACAATGACCCCACAGC-3′and CDH-2-R, 5′-TCCTGCTCACCACCACTACTT-3′; miR-125b, 5′-AATCCCTGAGACCCTAACTTGTGA-3′.

Bao X., Ren T., Huang Y., Wang S., Zhang F., Liu K., Zheng B, & Guo W. (2016). Induction of the mesenchymal to epithelial transition by demethylation-activated microRNA-125b is involved in the anti-migration/invasion effects of arsenic trioxide on human chondrosarcoma. Journal of Experimental & Clinical Cancer Research : CR, 35(1), 129.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated using TRIzol reagent (Invitrogen) and the miRNAs were extracted with RNeasy/miRNeasy Mini Kit (Qiagen, Limburg, The Netherlands). The reverse transcription was carried out with Super Script First Strand cDNA System (Invitrogen, Grand Island, NY, USA). All primer sequences are provided in Table 1.Table 1

Primers for Real-Time PCR

Primers		Sequences
E-cadherin	F	5′-TGCTCACATTTCCCAACTC-3'
E-cadherin	R	5′-TCTGTCACCTTCAGCCATC-3'
N-cadherin	F	5′-CTGACAATGACCCCACAGC-3'
N-cadherin	R	5′-TCCTGCTCACCACACTACTT-3'
Vimentin	F	5′-CTGGATTTCCTCTTCGTGGA-3'
Vimentin	R	5′-CGAAAACACCCTGCAATCTT-3'
GAPDH	F	5′-GCACCGTCAAGGCTGAGAAC-3'
GAPDH	R	5′-ATGGTGGTGAAGACGCCAGT-3'
miR-100-5p	F	5′-GTGTTCAAGCCTAGATGCCCAA-3'
miR-100-5p	R	5′-GCATCTAGGCTTGAACACGCC-3'
U6	F	5′-CTCGCTTCGGCAGCACA-3'
U6	R	5′-AACGCTTCACGAATTTGCGT-3'

Zhang H., Yang K., Ren T., Huang Y., Liang X., Yu Y., Wang W., Niu J., Lou J., Tang X, & Guo W. (2020). miR-100-5p Inhibits Malignant Behavior of Chordoma Cells by Targeting IGF1R. Cancer Management and Research, 12, 4129-4137.

+ Open protocol

+ Expand

Expression Analysis of ADAMTS9-AS1 and miR-513a-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated using TRIzol kit (Thermo Fisher Scientific) and miRNAs were extracted by RNeasy/miRNeasy Mini Kit (Qiagen, Limburg, the Netherlands). The reverse transcription was carried out with Super Script First Strand cDNA System (Thermo Fisher Scientific). U6 and GAPDH served as an endogenous control. The primer sequences were shown as following: ADAMTS9-AS1 (Forward: 5ʹ-CTCAGACCACAACTCTCCACCTTG-3ʹ, reverse: 5ʹ-CAGATGCTGCCTGGCTGATGG-3ʹ); miR-513a-5p (Forward: 5ʹ-TAAATTTCACCTTTCTGAGAAGG-3ʹ, reverse: 5ʹ-GCGAGCACAGAATTAATACGAC-3ʹ); U6 (Forward: 5ʹ-CTCGCTTCGGCAGCACA-3ʹ, reverse: 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ); GAPDH (Forward: 5ʹ-GTGAAGGTCGGAGTCAAC-3ʹ reverse: 5ʹ-GTTGAGGTCAATGAAGGG-3ʹ). The 2^−∆∆Ct method was used to calculate the relative abundance of RNA genes compared with GAPDH or U6 expression.

Fang S., Zhao Y, & Hu X. (2020). LncRNA ADAMTS9-AS1 Restrains the Aggressive Traits of Breast Carcinoma Cells via Sponging miR-513a-5p. Cancer Management and Research, 12, 10693-10703.

+ Open protocol

+ Expand

Quantifying miRNA Expression in Chordoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miRNAs were isolated from chordoma tissues or cell lines using an RNeasy/miRNeasy Mini Kit (Qiagen, Limburg, The Netherlands) according to the manufacturer’s instructions. Total RNA was isolated using TRIzol reagent (Invitrogen). The complementary DNAs (cDNAs) were synthesized using a RevertAid^TM First-Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania), and real-time quantitative PCR was carried out using SYBR-Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on a 7900 Real-Time PCR System (Applied Biosystems). U6 or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an endogenous control. The primers used in this study are listed in Table 2. All experiments were repeated at least three times.Table 2

Primers for real-time PCR

Primers		Sequences
E-cadherin	F	5′-TGCTCACATTTCCCAACTC-3'
E-cadherin	R	5′-TCTGTCACCTTCAGCCATC-3'
N-cadherin	F	5′-CTGACAATGACCCCACAGC-3'
N-cadherin	R	5′-TCCTGCTCACCACACTACTT-3'
Vimentin	F	5′-CTGGATTTCCTCTTCGTGGA-3'
Vimentin	R	5′-CGAAAACACCCTGCAATCTT-3'
GAPDH	F	5′-GCACCGTCAAGGCTGAGAAC-3'
GAPDH	R	5′-ATGGTGGTGAAGACGCCAGT-3'
Smad3	F	5′-GTCTGCAAGATCCCACCAG-3’
Smad3	R	5′-AGCCCTGGTTGACCGACT-3’
miR-16-5p	F	5′-TAGCAGCACGTAAATATTGGCG-3'
miR-16-5p	R	5′-TGCGTGTCGTGGAGTC-3’
U6	F	5′-CTCGCTTCGGCAGCACA-3'
U6	R	5′-AACGCTTCACGAATTTGCGT-3'

Zhang H., Yang K., Ren T., Huang Y., Tang X, & Guo W. (2018). miR-16-5p inhibits chordoma cell proliferation, invasion and metastasis by targeting Smad3. Cell Death & Disease, 9(6), 680.

+ Open protocol

+ Expand

Exosomal RNA Isolation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exosomal RNAs were extracted using TRIzol^® (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and miRNAs were extracted by the RNeasy/miRNeasy Mini kit (Qiagen, Inc.). The amount and quality of small RNAs in the total RNAs were tested by Heyuan Biotechnology (Shanghai) Co., Ltd. Small RNA library construction and sequencing were performed by Heyuan Biotechnology (Shanghai) Co., Ltd. Then, the cDNA library was sequenced on an Illumina Hiseq 2500 (Illumina, Inc.). Raw reads were collected using related Illumina analysis software and RT-qPCR was performed on a CFX96 Real-Time System (Bio-Rad Laboratories, Inc.) using iTaq Universal One-Step RT-qPCR kits (Bio-Rad Laboratories, Inc.). The PCR cycling conditions were: 94°C for 5 min, 94°C for 1 min, 55°C for 40 sec, 72°C for 50 sec, 72°C for 7 min and the temperature lowered to 4°C at the end of each cycles. The cycles were repeated 29 times. The probes and primers by a web based assay design software (Probe Finder http://www.roche-applied-science.com) to identify the expression of MDR-1 (MDR-1-f 5′-GCCATCAGTCCTGTTCTTGG-3′; MDR-1-r 5′-GCTTTTGCATACGCTAAGAGTTC-3′) and the results were expressed as the ratio between the MDR-1 and GAPDH according to the 2^−ΔΔCq method. RT-qPCR was repeated three times (11 (link)).

Cai T., Zhang C, & Zhan T. (2023). Transfer of exosomal microRNAs confers doxorubicin resistance in osteosarcoma cells. Molecular Medicine Reports, 27(4), 86.

+ Open protocol

+ Expand

Cytosolic RNA Isolation Using RNeasy

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by RNeasy/miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. For cytosolic RNA isolation, 700 μl of supernatant were mixed with 100% ethanol and transferred to an RNeasy spin column placed in a 2 ml collection tube. The column was centrifuged for 15 s at > 8000 g. The flow-through was discarded. The step was repeated to increase the RNA concentration. After washing with 500 μl of Buffer RW1, the RNA is treated with DNase I while bound to the RNeasy membrane. The DNase I is removed by a second wash with Buffer RW1. Washing with Buffer RPE and elution of RNA were then performed according to the standard protocols.

Zhou X., Backman L.J, & Danielson P. (2021). Activation of NF-κB signaling via cytosolic mitochondrial RNA sensing in kerotocytes with mitochondrial DNA common deletion. Scientific Reports, 11, 7360.

+ Open protocol

+ Expand

Quantifying miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of GCs was extracted using the RNeasy/miRNeasy Mini kit (Qiagen Benelux BV), according to the manufacturer's instructions. Total RNA (2 ng) was used for reverse transcription using the OneStep RT-PCT kit (Qiagen Benelux BV), following the manufacturer's instructions. The primers for miR-132 were the exact sequence of mature miR-132. U6 was used as the internal control. The primers were purchased from Qiagen Benelux BV. The thermocycling conditions for miRNA were as follows: 95°C for 15 min, followed by 95°C for 15 sec, and 60°C for 1 min (40 cycles). For the mRNA expression of Foxa1, GAPDH was used as the internal control. The primer sequences for Foxa1 and GAPDH were as follows: Foxa1 sense, 5′-AGGGCTGGATGGTTGTATTG-3′ and antisense, 5′-GCCTGAGTTCATGTTGCTGA-3′; GAPDH sense, 5′-GAAGGTGAAGGTCGGAGTC-3′ and antisense, 5′-GAAGATGGTGATGGGATTTC-3′. The thermocycling conditions for Foxa1 were as follows: 95°C for 5 min; 35 cycles of 95°C for 1 min, and 60°C for 1 min and 72°C for 1 min; and then 72°C for 7 min. RT-qPCR was performed in triplicate using a SYBR^® Premix Ex Taq Kit (Takara Bio, Inc.), according to the manufacturer's protocol, on a CFX96 Real-time PCR system (Bio-Rad Laboratories, Inc.). All reactions were run in triplicate and gene expression was determined using the 2^−∆∆Cq method (17 (link)).

Cui X., Jing X., Liu J., Bi X, & Wu X. (2020). miR-132 is upregulated in polycystic ovarian syndrome and inhibits granulosa cells viability by targeting Foxa1. Molecular Medicine Reports, 22(6), 5155-5162.

+ Open protocol

+ Expand

Quantification of miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tissues or cells using the RNeasy/miRNeasy Mini kit (Qiagen, Hilden, Germany).1 μg of total RNAs was reverse‐transcribed to complementary DNAs using the SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Real‐time PCR were performed on a 7500 Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA) using the SYBR Green PCR Master Mix (Applied Biosystems). The following primers were used: miR‐9: 5′‐tctttggttatctagctgtatga‐3′ (sense), 5′‐tggtgtcgtggagtcg‐3′ (antisense); U6: 5′‐ctcgcttcggca gcaca ‐3′ (sense), 5′‐aacgcttcacgaatttgcgt‐3′ (antisense); SOX7: 5′‐cctctccttcttgtgccttg‐3′ (sense), 5′‐gggagacagcaactctcagg‐3′ (antisense); GAPDH: 5′‐cgaccactttgtcaagctca‐3′ (sense), 5′‐aggggagattcagtgtggtg‐3′ (antisense). The threshold cycle (Ct) of target genes was normalized to that of the internal control.

Han L., Wang W., Ding W, & Zhang L. (2017). MiR‐9 is involved in TGF‐β1‐induced lung cancer cell invasion and adhesion by targeting SOX7. Journal of Cellular and Molecular Medicine, 21(9), 2000-2008.

+ Open protocol

+ Expand

Quantifying miR-101 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNeasy/miRNeasy Mini kit (Qiagen, Limburg, The Netherlands) according to the manufacturer's protocols. Total RNA (5 ng) was used for reverse transcription, using the RevertAid™ First Strand cDNA Synthesis kit (Fermentas, Vilnius, Lithuania). The primers for miR-101 were the exact sequence of mature miR-101. They were purchased from GenScript (Nanjing, China). PCR was performed with the SYBR-Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on the ABI PRISM 7700 Sequence detection system (Applied Biosystems). The relative expression of miR-101 was calculated by the 2^−ΔΔCt method that was normalized to the U6 internal control.

Qian L., Zhang W., Lei B., He A., Ye L., Li X, & Dong X. (2016). MicroRNA-101 regulates T-cell acute lymphoblastic leukemia progression and chemotherapeutic sensitivity by targeting Notch1. Oncology Reports, 36(5), 2511-2516.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!