The largest database of trusted experimental protocols

6 protocols using lentivirus

1

HSPB7 Overexpression and Knockdown Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to overexpress HSPB7, the lentivirus expressing HSPB7 and the scramble negative control (NC) were purchased from Cyagen Company (Guangzhou, China). For HSPB7 knockdown, recombinant lentiviruses targeting HSPB7 (shHSPB7-1 and shHSPB7-2) and the non-targeting negative control (shNC) were purchased from GenePharma Co. (Shanghai, China). The shRNA sequences were as follows: shNC, TTCTCCGAACGTGTCACGT; shHSPB7-1, ACAGAACCUCUUCCACCUUTT; and shHSPB7-2, GAACACCUUCGCUCACAAGTT. For virus transfection, cells were exposed to the lentiviral supernatant with the addition of polybrene (5 μg/mL, Sigma-Aldrich) for 24 h. After 72 h, antibiotic selection was conducted by adding puromycin (5 μg/mL, Sigma-Aldrich) to transfected cells.
+ Open protocol
+ Expand
2

Culturing Murine Leukemia and Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
L1210 murine leukemia cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS), 2 mM l-glutamine, 100 µg/mL streptomycin, and 100 U/mL penicillin. Cells were maintained in 5% CO2 to 95% air. To culture bone marrow-derived macrophages (BMDMs), mononuclear cells were isolated from tibias and femurs of C57BL/6 mice. Cells were cultured at a density of 2 × 106/mL in DMEM containing 10% FBS and 25 ng/mL murine macrophage-colony stimulating factor (M-CSF) (PeproTech, Rocky Hill, NJ, USA) for 7 days. In some experiments, IFNγ (20 ng/mL, PeproTech), LPS (50 ng/mL, Sigma, St. Louis, MO, USA), or IL4 (20 ng/mL, PeproTech) was added and cultured for 24 h before further analyses. Macrophages treated with PBS, LPS + IFNγ, or IL4 were named as MPBS, MLPS, or MIL4, according to Epelmann et al. (5 (link)). Cells were transfected siRNA with Lipofectamine LTX (Invitrogen) according to the recommended protocol. Three pairs of siRNA for each target were designed and their knockdown efficiency was determined by qRT-PCR and Western blotting. The siRNA with highest efficiency was chosen for further experiments. Lentivirus was packaged by Cyagen Biosciences with commercial service (Guangzhou, China).
+ Open protocol
+ Expand
3

Tracking Fate of Prx1+ and Prx1- MSCs in Bone Defect

Check if the same lab product or an alternative is used in the 5 most similar protocols
To trace the cell fate of Prx1+ MSCs and Prx1 MSCs, they were labelled with GFP using lentivirus (Cyagen Biosciences) and transplanted into the mice (n = 3 per group) with femoral bone defect. At 2 weeks after surgery, femurs were harvested, and fixed samples were decalcified, dehydrated and embedded in Tissue‐Tek® OCT Compound (SAKURA). The 10 μm thickness of sagittal sections was cut with a freezing microtome (Thermo Scientific). The sections were blocked in 5% BSA for 40 minutes at room temperature and incubated with the primary antibodies anti‐DMP1 (1:400; Abcam) and anti‐GFP (1:400; Abcam) at 4°C overnight. After washing, the sections were then incubated with the respective secondary antibodies (1:500; Abcam) for 1 hour at room temperature and sealed with DAPI. The images were captured with a fluorescence microscope (Zeiss). For DMP1 quantification, Image J (1.52 version) was used to calculate the area percentage of DMP1 in the bone defect healing area.
+ Open protocol
+ Expand
4

In Vivo Tracking of Labeled Exosomes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MSC-Exos was labeled with a lipophilic fluorescent dye (DiR; Invitrogen) to detect their biodistribution in vivo using an in vivo fluorescence imager (IVIS Spectrum). To evaluate the effect of exosomes on BMSCs in vivo, BMSCs labeled with enhanced green fluorescent protein using lentivirus (Cyagen Biosciences) were injected into the humeral of mice at a density of 1×106. After 2 weeks of treatment, the mice were sacrificed for immunofluorescence staining as previously described.27 (link)
Primary antibodies anti-GFP (1:400) and secondary antibodies (1:500) were purchased from Abcam. Finally, the slices were sealed with DAPI (4′,6-diamidino-2-phenylindole) and observed with a fluorescence microscope (Zeiss).
+ Open protocol
+ Expand
5

Lentiviral Transduction of HT22 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus was bought from company (CyagenBiosciences, Guangzhou, China). When the HT22 cells were attached, the culture medium containing lentivirus and polybrene (5 ug/ml) was added it for 8 h. After 8 hours, the medium containing virus and polybrene was removed, and then a new virus-free and polybrene-free medium was added it. By observation, it was found that over 80 to 90% cells had fluorescence expression, which proved that lentivirus infection was successful and could be used in experiments (it can be screened with antibiotics).
+ Open protocol
+ Expand
6

Stable Knockdown of PLXND1 in THP-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For stable knockdown of PLXND1, THP-1 cells were transduced with short hairpin RNA (sh-PLXND1 and sh-Control) in lentiviral particles containing a green fluorescent protein (GFP). In brief, cells were cultured with short-hairpin-containing lentiviral supernatants in the presence of 5 μg/mL polybrene for 12 h. After 48 h, transduction efficiency was determined by fluorescence microscopy. After transfection, cells were treated with the indicated drugs for another 24 h. The transduced cells with lentivirus used in this study were obtained from Cyagen Biosciences Inc. (Suzhou, China). The shRNA sequence was 5′-CCAAGTGTTCCTCCCTTTATGCTCGAGCATAAAGGGAGGAACACTTGG-3′. The knockdown efficiency was routinely confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) [24 (link)]. The forward primer sequence was AATGGGCGGAACATCGTCAAG and the reverse primer sequence was CGAGACTGGTTGGAAACACAG. These transfected cells were further used for differentiation into macrophages.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!