To construct a BAC library of the grapevine cv. ‘Börner’ young frozen leaf material was sent to Bio S&T Inc. (Montreal, Canada) as a service provider for the generation of BAC libraries. The DNA was inserted into the vector pIndigoBAC-5 (Epicentre, Madison, USA; ENA/GenBank accession number EU140754) cut with HindIII. Competent cells of Escherichia coli strain DH10B were transformed with the ligation mix and plated on LB medium supplemented with 12.5 µg/mL chloramphenicol (CM), 40 µg/mL X-GAL and 0.2 mM IPTG. White colonies were picked and transferred in 384-well microtiter plates filled with LB freezing medium (Zimmer and Verrinder Gibbins, 1997 (link)) containing CM. Altogether, 159 microtiter plates with 384 wells were generated, and these were duplicated and stored at -80°C. The insert size was estimated by pulsed-field gel electrophoresis to be on average 93 kbp. The library coverage is almost 12 haploid genome equivalents based on a genome size of about 500 Mbp (Lodhi and Reisch, 1995 (link)).
Pindigobac 5
Manufactured by Illumina
Sourced in United States
The PIndigoBAC-5 is a laboratory instrument designed for the high-throughput isolation and purification of large-insert bacterial artificial chromosome (BAC) clones. The device utilizes an automated workflow to extract and purify BAC DNA from bacterial cultures, providing a reliable and efficient method for the preparation of samples for downstream genomic applications.
Automatically generated - may contain errors
Lab products found in correlation
8 protocols using pindigobac 5
1
Constructing a Grapevine BAC Library
2
BAC DNA Isolation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A PhasePrep BAC DNA Kit (Sigma) was used to isolate bacterial DNA, and the BAC ends were sequenced using the following pIndigoBAC5 (Epicentre, Illumina) sequencing primers: 5′ end, CTCGTATGTTGTGTGGAATTGTGAGC, and 3′ end, GGATGTGCTGCAAGGCGATTAAGTTGG. Chromas Lite 2.01 (Technelysium Pty Ltd) was used to verify the chromatograms and identify mis-call sequencing errors. The BAC-end sequences (BESs) obtained using the 3′ and 5′ primers were given the “_3” and “_5” suffixes, respectively.
3
Spirodela BAC Library Construction and Mapping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Spirodela BAC library was constructed from high-molecular weight nuclear DNA35 (link). The DNA was partially digested with HindIII, double size-selected and ligated into pIndigoBAC-5 (HindIII-cloning Ready, Epicentre, BACH095H, Madison, WI, USA). A total of 15,360 Spirodela BAC clones with an average insert size of 110 kb representing 10 × genome equivalents were fingerprinted with the SNaPshot HICF fingerprinting method using the LIZ1200 size standard as described somewhere else39 (link). Of the 15,360 fingerprinted clones, 11,770 clones (76.6%) were suitable for contig assembly. There was on average one restriction fragment every 1.19 kb. The final FPC map spanned 200 Mb and contained 269 singletons and 11,501 BAC clones, which were integrated into 320 contigs. In the physical map, 23 contigs had more than 100 clones each, 62 contigs had 50–99 clones each, 160 contigs had 10–49 clones and the residual 75 had <10 clones. Based on the physical map integration, the Newbler scaffolds were ordered by the FPC draft sequence function and pseudomolecules were constructed from joined scaffolds. Scaffolds within one pseudomolecule were interlaced by a stretch of 500 undefined bases (‘N’s).
4
Multiplexed Capture and Sequencing of Select Genes
5
Constructing and Sequencing Sorghum BAC Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BAC (bacterial artificial chromosome) libraries were constructed from young leaves of Nakei-MS3B; they contained 39,267 (average insert size 134 kb) clones, respectively. We used conventional methods, namely a partial DNA digest with HindIII enzyme, size fractionation of high-molecular-weight DNA by pulsed-field gel electrophoresis (CHEF; Bio-Rad Laboratories, USA), and vector ligation (pIndigoBAC-5; Epicentre Biotechnologies Madison, WI, USA) and transformation into E. coli (DH10B strain). Positive BAC clones covering the region of the F3′H gene were screened from each library by using tightly linked DNA markers through PCR amplification, and subjected to shotgun sequencing to give approximately 10-fold sequence coverage using a previously described method
[16 (link)]. A BAC clone containing inserts from the F3′H region—namely MS3B_108E24 (183 kb)—from Nakei-MS3B was found by PCR analysis by using SB20978 and SB20980 (Additional file
1 : Table S1). The BAC sequences were produced by Sanger shotgun sequencing of subclones followed by assembly of the shotgun sequences. The sequences of candidate genes were obtained from the sorghum genome database (http://www.plantgdb.org ) and used for gene expression analysis.
[16 (link)]. A BAC clone containing inserts from the F3′H region—namely MS3B_108E24 (183 kb)—from Nakei-MS3B was found by PCR analysis by using SB20978 and SB20980 (Additional file
6
Bacterial Degradation of Triphenylbenzene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial strains and culture conditions.
The procedure for BAC (Bacterial Arti cial Chromosome) library construction was described in detail elsewhere [23] . Brie y, bacterial DNA was extracted from the combined caecal and colon contents of seven BALB/c mice and digested with HindIII restriction enzyme. The size-selected DNA was cloned into pIndigoBAC-5 (HindIII cloning-ready; Epicentre), and transformed into E. coli DH10B. Successfully transformed E. coli DH10B was grown in Luria Broth (LB, 10 g tryptone, 5 g NaCl, 5 g yeast extract per litre) supplemented with 25 µg/ml of chloramphenicol (Duchefa Biochemie, Haarlem, Netherlands) at 37 °C. The indigenous non-pathogenic E. coli strains tEc (typical E. coli) was isolated from CD-1 mouse intestines in a previous study [30] . This information is summarised in Table 3.
Screening of BAC library clones for TB degrading ability.
For TB degradation assay, bacteria were grown on TB agar (TBA; 4 g peptone, 3 g NaCl, 3 g yeast extract, 15 g agar, 20 mM TB per litre and 0.02% of triton X-100 as a surfactant) at 37 °C for 48 h. As TB in the media gets degraded by the hydrolytic activity of bacteria, distinct clear zones form around the bacterial colonies.
The procedure for BAC (Bacterial Arti cial Chromosome) library construction was described in detail elsewhere [23] . Brie y, bacterial DNA was extracted from the combined caecal and colon contents of seven BALB/c mice and digested with HindIII restriction enzyme. The size-selected DNA was cloned into pIndigoBAC-5 (HindIII cloning-ready; Epicentre), and transformed into E. coli DH10B. Successfully transformed E. coli DH10B was grown in Luria Broth (LB, 10 g tryptone, 5 g NaCl, 5 g yeast extract per litre) supplemented with 25 µg/ml of chloramphenicol (Duchefa Biochemie, Haarlem, Netherlands) at 37 °C. The indigenous non-pathogenic E. coli strains tEc (typical E. coli) was isolated from CD-1 mouse intestines in a previous study [30] . This information is summarised in Table 3.
Screening of BAC library clones for TB degrading ability.
For TB degradation assay, bacteria were grown on TB agar (TBA; 4 g peptone, 3 g NaCl, 3 g yeast extract, 15 g agar, 20 mM TB per litre and 0.02% of triton X-100 as a surfactant) at 37 °C for 48 h. As TB in the media gets degraded by the hydrolytic activity of bacteria, distinct clear zones form around the bacterial colonies.
7
Development of a BAC Library for Resistance Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A BAC library was constructed with pIndigoBAC-5 (Hind III-Cloning Ready) for a heterozygous resistant plant K182 carrying the Rpi-mcq1 followed the instrument (Epicentre, WI, USA). The library is approximately 9× coverage with an average insert size of 85 kb. The BAC library was pooled for each 384-well plate and screened by PCR using the flanking and co-segregating makers. Positive clones were validated by singleton PCR.
8
Construction and Screening of BAC Library
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial strains and culture conditions.
The procedure for BAC (Bacterial Arti cial Chromosome) library construction was described in detail elsewhere [23] . Brie y, bacterial DNA was extracted from the combined caecal and colon contents of seven BALB/c mice and digested with HindIII restriction enzyme. The size-selected DNA was cloned into pIndigoBAC-5 (HindIII cloning-ready; Epicentre), and transformed into E. coli DH10B. Successfully transformed E. coli DH10B was grown in Luria Broth (LB, 10 g tryptone, 5 g NaCl, 5 g yeast extract per litre) supplemented with 25 μg/ml of chloramphenicol (Duchefa Biochemie, Haarlem, Netherlands) at 37°C. The indigenous non-pathogenic E. coli strains tEc (typical E. coli) was isolated from CD-1 mouse intestines in a previous study [31] . Lactococcus lactis (KCTC 3619) was cultured anaerobically in Brain Heart Infusion (BHI) broth at 37 °C. Streptococcus pneumoniae (ATCC 49619) was cultured aerobically in BHI broth at 37 °C. This information is summarised in Table 3.
Screening of BAC library clones for TB degrading ability.
For TB degradation assay, bacteria were grown on TB agar (TBA; 4 g peptone, 3 g NaCl, 3 g yeast extract, 15 g agar, 20 mM TB per litre and 0.02% of triton X-100 as a surfactant) at 37 °C for 48h. As TB in the media gets degraded by the hydrolytic activity of bacteria, distinct clear zones form around the bacterial colonies.
The procedure for BAC (Bacterial Arti cial Chromosome) library construction was described in detail elsewhere [23] . Brie y, bacterial DNA was extracted from the combined caecal and colon contents of seven BALB/c mice and digested with HindIII restriction enzyme. The size-selected DNA was cloned into pIndigoBAC-5 (HindIII cloning-ready; Epicentre), and transformed into E. coli DH10B. Successfully transformed E. coli DH10B was grown in Luria Broth (LB, 10 g tryptone, 5 g NaCl, 5 g yeast extract per litre) supplemented with 25 μg/ml of chloramphenicol (Duchefa Biochemie, Haarlem, Netherlands) at 37°C. The indigenous non-pathogenic E. coli strains tEc (typical E. coli) was isolated from CD-1 mouse intestines in a previous study [31] . Lactococcus lactis (KCTC 3619) was cultured anaerobically in Brain Heart Infusion (BHI) broth at 37 °C. Streptococcus pneumoniae (ATCC 49619) was cultured aerobically in BHI broth at 37 °C. This information is summarised in Table 3.
Screening of BAC library clones for TB degrading ability.
For TB degradation assay, bacteria were grown on TB agar (TBA; 4 g peptone, 3 g NaCl, 3 g yeast extract, 15 g agar, 20 mM TB per litre and 0.02% of triton X-100 as a surfactant) at 37 °C for 48h. As TB in the media gets degraded by the hydrolytic activity of bacteria, distinct clear zones form around the bacterial colonies.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!