The intron 2 region was amplified from genomic DNA with GoTaq G2 Flexi DNA polymerase (Promega, M7801) in a final volume of 20 μl as follows: 1 μl of crude lysate was added to 5 μl 5X Green GoTaq Flexi Buffer, 8 μl 25 mM MgCl2, 1 μl 10 mM dNTP mix (Promega, U1511), 1 μl F and R primer (100 pmol), 0.25 μl GoTaq G2 Flexi DNA polymerase, 3.75 μl DNAse/RNAse-free water and amplified as follows: initial denaturation 95 °C for 2 min, followed by 35 cycles (denaturation 95 °C for 30 s, primer annealing temperature (TA) oC for 30 s, and extension 72 °C for 15 s with a final extension at 72 °C for 5 min) using primers Hco-Indel-F and R, or Hco-Indel-F and Hco-Indel-Ins-R. All PCR products were visualised on 2% agarose gel with SafeView Nucleic Acid Stain. Identity of PCR products was confirmed by capillary sequencing (Eurofins, Ebersberg, Germany).
Gotaq g2 flexi dna polymerase
Manufactured by Promega
Sourced in United States
GoTaq G2 Flexi DNA Polymerase is a thermostable DNA polymerase enzyme used for DNA amplification in polymerase chain reaction (PCR) applications. It exhibits 5'->3' polymerase activity and 3'->5' exonuclease activity.
Automatically generated - may contain errors
Lab products found in correlation
Green gotaq flexi buffer, by Promega (6 mentions)
Goscript reverse transcription system, by Promega (5 mentions)
Qiaquick gel extraction kit, by Qiagen (4 mentions)
Gotaq flexi buffer, by Promega (4 mentions)
Dntp mix, by Promega (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Mgcl2, by Promega (3 mentions)
C1000 touch thermal cycler, by Bio-Rad (3 mentions)
Molecular imager gel doc xr, by Bio-Rad (3 mentions)
Gotaq g2 flexi buffer, by Promega (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Gel red 10 000x, by Biotium (2 mentions)
Chemidoc mp photodocumentation system, by Bio-Rad (2 mentions)
Sybr safe dna gel stain, by Thermo Fisher Scientific (2 mentions)
Q5 polymerase, by New England Biolabs (2 mentions)
Rprotk ro, by Merck Group (2 mentions)
Green gotaq reaction buffer, by Promega (2 mentions)
Spectrum plant total rna kit, by Merck Group (2 mentions)
E z n a tissue dna kit, by Omega Bio-Tek (2 mentions)
Image lab 4, by Bio-Rad (2 mentions)
104 protocols using gotaq g2 flexi dna polymerase
1
Amplification and Sequencing of Intron 2
2
Genetic Screening for Thyroid Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genetic screening for hotspot mutations in BRAF (exon 15), NRAS (exon 2) and TERT (promoter region) was performed by Polymerase Chain Reaction (PCR) using GoTaq® G2 Flexi DNA Polymerase (Promega, Madison, WI, USA), as previously described in Castro et al. [55 (link)] and Vinagre, et al. [35 (link)].
Synthetized cDNA was analysed by PCR using GoTaq® G2 Flexi DNA Polymerase (Promega, Madison, WI, USA) for the presence of PAX8-PPARɣ and RET/PTC rearrangements according to the procedures described by Marques, et al. [56 (link)] for PAX8-PPARɣ and Lima, et al. [57 (link)] for RET/PTC1 and RET/PTC3.
Synthetized cDNA was analysed by PCR using GoTaq® G2 Flexi DNA Polymerase (Promega, Madison, WI, USA) for the presence of PAX8-PPARɣ and RET/PTC rearrangements according to the procedures described by Marques, et al. [56 (link)] for PAX8-PPARɣ and Lima, et al. [57 (link)] for RET/PTC1 and RET/PTC3.
3
Genetic Analysis of Mollusk Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specimens were selected for genetic analysis, and genomic DNA was extracted from a single individual using the Mollusc DNA Kit (Omega), following the manufacturer's protocols and with the modifications suggested in20 (link). Subsequently, the concentration of the extracted DNA was quantified, and the presence of contaminants was verified using a Nanodrop. Finally, the DNA was stored at − 20 °C.
To perform the genetic analyses, two genes were employed: the mitochondrial gene encoding the cytochrome c oxidase subunit I (COI) and the nuclear gene encoding the small subunit of the ribosome (18S). The primers used to amplify each gene fragment, along with the observed and expected fragment lengths and the hybridization temperatures during PCR amplification cycle are specified in supplementary materials TableS4 . PCR amplification was conducted in a total volume of 30 μL, where included 3 μL of 5X Green GoTaq G2 Flexi Buffer, 3 μL of 25 mM MgCl2, 0.5 μL of dNTPs (10 mmol L−1), 0.5 μL of each primer (100 pmol µL−1), 0.045 units of GoTaq G2 Flexi DNA Polymerase (Promega), and 5 μL of DNA from each individual. The PCR products were verified by electrophoresis on 1.2% agarose gel. Subsequently, the amplified products were sent to Macrogen for sequencing. To avoid ambiguous readings of certain nucleotides, the PCR products were sequenced in both directions (forward and reverse).
To perform the genetic analyses, two genes were employed: the mitochondrial gene encoding the cytochrome c oxidase subunit I (COI) and the nuclear gene encoding the small subunit of the ribosome (18S). The primers used to amplify each gene fragment, along with the observed and expected fragment lengths and the hybridization temperatures during PCR amplification cycle are specified in supplementary materials Table
4
Molecular Identification of Parasitic Nematode
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Successful worm lysis and molecular verification of larval identity was confirmed by PCR-amplifying a fragment of the nuclear ribosomal internal transcribed spacer-2 (ITS-2) region with the T. circumcincta-specific primers TcF (5′-ATACCGCATGGTGTGTACGG-3′) and TcR (5′- CAGGAACGTTACGACGGTAAT-3′) from Burgess et al. (2012) (link). Each 10 μl reaction contained GoTaq® flexi buffer, 2.5 mM MgCl2, 0.2 mM each dNTP, 0.5 μM of each primer, 0.25 U GoTaq® G2 Flexi DNA polymerase (Promega) and 1 μl of diluted gDNA lysate. Touchdown PCR was conducted with the following thermocycling conditions: 95 °C for 8 min, followed by 12 three-step cycles of 94 °C for 15 s, 62 °C for 15s reducing by 0.5 °C/cycle and 72 °C for 30 s, 25 three-step cycles of 94 °C for 15 s, 56 °C for 55 s and 72 °C for 30 s, followed by a final extension step at 72 °C for 7 min.
5
Quantification of XBP1 Splicing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted and reverse transcribed as previously described (Cox et al., 2011 ). Protocols for quantification of splicing of XBP1 were described previously (Cox et al., 2011 ; Brown et al., 2016 (link)). qPCRs were run on a Rotorgene 3000 (Qiagen, Crawley, UK) using GoTaq G2 Flexi DNA polymerase (Promega, Southampton, UK; cat. no. M7801) and analyzed as described before (Brown et al., 2016 (link)). Primer sequences are listed in Table 2 or have been reported before (Brown et al., 2016 (link)). Amplification of a single PCR product was confirmed by recording the melting curves after each PCR. The amplification efficiencies for all qPCRs were ∼0.75 ± 0.05. Results represent the average and SE of three technical repeats. qPCR results were confirmed by at least one other biological replicate.
6
Quantitative Analysis of BKCa, FoxO3a, and Atrogin-1 Expression in PCASMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from PCASMCs was extracted using total RNA reagent (RNAiso Plus, TaKaRa Biotechnology, China) and mRNA was converted to cDNA using reverse transcriptase kit (PrimeScript™ RT Master Mix, TaKaRa Biotechnology, China) according to manufacturer's instructions. PCR amplification was performed with Taq DNA polymerase (GoTaq® G2 Flexi DNA Polymerase, Promega, USA) and the thermal cycling conditions were: 95°C for 30s, followed by 30 cycles of 95°C for 30s, 50°C for 1 min, 72°C for 1 min, and completed by 72°C for 5 min. PCR products were then separated by 1.5% agarose gel electrophoresis. Density analysis of the signals was evaluated using the GelQuant.NET 1.8.2 software (Biochem Lab Solutions, University of California, San Francisco). Primers used for PCR amplification were as follows: BKCa α, 5’-GCCAGCAACTTTCACTAC-3’ (forward) and 5’-CTGACAGGATAACGCACA-3’ (reverse); BKCa β1, 5’-TGTGCTGTCATCGCCTACT-3’ (forward) and 5’-ACCTGGTGCTCGTGGAAC-3’ (reverse); FoxO3a, 5’-ACATGGCCGGAACCATGAAT-3’ (forward) and 5’-GTCCAAACACTGTGCTGCTG-3’ (reverse); atrogin-1, 5’-TGGATGGCTGGGGATACAGA-3’ (forward) and 5’-TAAATTCCCCGCCAGTGTCC-3’ (reverse). GAPDH was amplified in parallel as an internal loading control with primers 5’-GGTCGGAGTGAACGGATTT-3’ (forward) and 5’-ATTTGATGTTGGCGGGAT-3’ (reverse).
7
Multiplex PCR for Phylotype Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phylotype was determined by multiplex PCR using a set of phylotype-specific primers Nmult:21:1F, Nmult:21:2F, Nmult:22:InF, Nmult:23:AF, and Nmult21:RR (Fegan and Prior, 2005 ). Amplification was carried out in a total volume of 15 μl containing 1 X PCR buffer, 2.5 mM MgCl2, 0.2 mM of each dNTP, 0.2 μM of each primer, 0.3 U of GoTaq G2 Flexi DNA polymerase (PROMEGA) and 1 μl DNA template. Amplifications were performed in an Applied Biosystem Veriti thermocycler as follows: an initial denaturation step at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 23 s, and a final extension step at 72°C for 5 min. PCR products (10 μl) were analyzed by electrophoresis through 1% (w/v) agarose gels with 0.01 μl /ml GelRedTM 10,000X (Biotium) and photographed under UV light in The ChemidocTM MP Photodocumentation System (BIO-RAD). DNA template from strains CIP-277 (phylotype I), CIP-435 (phylotype II), and CIP-358 (phylotype III) were used as positive amplification controls. The size of the amplified fragments was estimated by comparison with a 1 Kb Plus marker ladder.
8
Genetic Barcoding using 16S rRNA and COI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences of the 16S rRNA and COI genes were amplified by PCR using the primers listed in supplementary Table S2 . PCR amplification was carried out using GoTaq G2 Flexi DNA polymerase (Promega, WI, USA). The reaction master mix was prepared according to the manufacture’s protocol and the PCR conditions described in previous studies were used37 ,38 (link). All PCRs were run with positive and negative controls. PCR products were separated using gel electrophoresis in 1% agarose gels, stained with SYBR Safe DNA Gel Stain (Invitrogen, CA, USA) and visualized under ultra-violet light.
9
TRPC3 Expression in PCAECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from PCAECs was extracted using RNAiso reagent (Takara) and mRNA was converted to cDNA using PrimeScriptTM RT Master Mix (Takara), according to manufacturer’s instructions. PCR amplification was performed using GoTaq® G2 Flexi DNA Polymerase (Promega). For TRPC3 amplification, PCR parameters were as follows: 95 °C activation (30 s) followed by 95 °C dissociation (30 s), 46.6 °C anneal (30 s), and 72 °C elongation (1 min) for 30 cycles. Primers used for TRPC3 amplification were: forward: 5′GCAACAAAGGCACAGCAGTA3′, reverse: 5′TTGAGCACAACGGAAGTCAC3′. As the internal loading control, GAPDH was amplified for 30 cycles with the forward primer 5′GGTCGGAGTGAACGGATTT3′ and the reverse primer 5′ATTTGATGTTGGCGGGAT3′ under the following condition: activation (95 °C, 30 s) - dissociation (94 °C, 30 s) - anneal (43.3 °C, 30 s) - elongation (72 °C, 1 min). Products were identified by electrophoresis and digitally imaged for analysis (Geliance 600 Imaging System, PerKinElmer, UK).
10
Molecular Identification of Anopheles Malaria Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A ~ 225 bp fragment of the kdr region in the VGSC gene, spanning codons 1010, 1013 and 1014 of An. darlingi (228 bp, between exons 20 and 21), An. albimanus (225 bp, between exons 22 and 23) and An. nuneztovari s.l. (226 bp), was amplified using primers designed for An. albimanus, AAKDRF2 (5′CATTCATTTATGATTGTGTTTCGTG3′) and AAKDRR (5′GCAANGCTAAGAANAGRTTNAG) [18 (link)]. The PCR mixture (50 µl) consisted of 0.5–2.0 µmol/ml DNA template, 1 U/µl GoTaq® G2 Flexi DNA Polymerase (Promega), 1× Green GoTaq® Flexi Buffer, 0.5 mM dNTPs, 2.5 mM MgCl2, 1.5 μM AAKDRF2 and 1.5 µM AAKDRR. The reaction program was 95 °C for 3 min, followed by 35 cycles each with 95 °C for 1 min, 45 °C for 1 min, 72 °C for 1 min, and by a final extension of 10 min at 72 °C. PCR products were analysed by electrophoresis in 2.5% (w/v) agarose gel containing SafeView Plus (Fermelo Biotec).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!