Abi 3130xl genetic analyser

5 µm FFPE tissue sections were stained using hematoxylin&eosin, histologically analyzed and manually microdissected to obtain DNA. MSI status was determined using a combination of three mononucleotide markers (BAT25, BAT26, CAT25) and three dinucleotide markers (D2S123, D5S346, D17S250) as described previously (11 ). B2M mutation status was determined using targeted sequencing, as previously (12 (link)). Briefly, PCR amplification of B2M exons 1 and 2 was performed using primer sequences: Exon 1 For— GGCATTCCTGAAGCTGACA, Exon 1 Rev— AGAGCGGGAGAGGAA GGAC, Exon 2a For—TTTCCCGATATTCCTCAGGTA, Exon 2a Rev— AATTCAGTGTAGTACAAGAG and Exon 2b For—TGTCTTTCA GCAAGGACTGG, Exon 2b Rev—CAAAGTCACATGGTTCACACG. The obtained PCR products (QIAquick PCR Purification Kit) were purified, and the sequencing reaction was performed using the BigDye^® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Wilmington, DE, USA). After dissolving the precipitated products in 12 μl of HiDi Formamide (Thermo Fisher Scientific, Wilmington, DE, USA), sequencing was performed on ABI 3130xl Genetic Analyser and analyzed using Sequencing Analysis Software V6.0 (Applied Biosystems). B2M protein expression was analyzed by immunohistochemistry staining using a standard protocol described before (13 (link)).

Primers and conditions for the PCR amplification of STR markers D6S2854 and D6S2859 have previously been described (Doxiadis et al. 2011 (link); Wiseman et al. 2007 (link)). Briefly, PCR reactions were multiplexed in a 25-μl reaction volume containing 1 unit of Taq polymerase (Invitrogen, Paisley, Scotland) with 0.3 μM of the forward and reverse primer of D6S2859, 0.1 μM of the forward and reverse primer of D6S2854, 5 mM MgCl₂, 0.2 mM of each dNTP, 1× PCR buffer II (Invitrogen, Paisley, Scotland), and 100 ng DNA. The cycling parameters were a 5-min 94 °C initial denaturation step, followed by 5 cycles of 1 min at 94 °C, 45 s at 58 °C and 45 s at 72 °C. The programme was followed by 25 cycles of 45 s at 94 °C, 30 s at 58 °C and 45 s at 72 °C. A final extension step was performed at 72 °C for 30 min. The amplified DNA was prepared for genotyping and analysed on an ABI 3130XL genetic analyser (Applied Biosystems). STR analysis was performed using the Genemapper software (Applied Biosystems).

The positive amplicons were sequenced using a BigDye Terminator 3·1v Cycle Sequencing Kit on an ABI3130xl genetic analyser (Applied Biosystems/Life Technologies, Paisley, UK). Sequence alignments and maximum likelihood phylogenetic trees were generated in MEGA6·06. A Tamura three-parameter nucleotide substitution model with γ rate variation was determined to best fit the data using Akaike Information Criterion (AIC) in MEGA 6·0 [28 (link)], with bootstrap replications of 10 000 [29 (link)].