Serca2

Manufactured by Cell Signaling Technology

Sourced in United States

SERCA2 is a calcium pump found in the sarcoplasmic reticulum of cardiac and skeletal muscle cells. It functions to transport calcium ions from the cytoplasm into the sarcoplasmic reticulum lumen, playing a crucial role in muscle contraction and relaxation.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Anti-SERCA2 (5 citations) ATP2A2/SERCA2 (3 citations) Rabbit anti-SERCA2 (2 citations) Sarcoplasmic Ca-ATPase(SERCA2) (2 citations)

7 protocols using serca2

Comprehensive Protein Detection Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunoblotting and co-immunoprecipitation: Actin (Santa Cruz, ♯sc-47778; 1:5000), ATF6 (Cell Signaling Technology, ♯65880; 1:1000), BCL-2 (AbCam, ♯ab182858; 1:500), BCL-XL (Cell Signaling Technology, ♯2764; 1:1000), Cleaved-Caspase-8 (Cell Signaling Technology, ♯8592; 1:1000), Caspase-3 (Cell Signaling Technology, ♯9665; 1:1000), Caspase-9 (Cell Signaling Technology, ♯9508; 1:1000), CHOP (Cell Signaling Technology, ♯2895; 1:250), GFP (AbCam, ♯ab13970; 1:2000), GRP78 (Cell Signaling Technology, ♯3177; 1:1000), FLAG-HRP (Sigma Aldrich, ♯A8592; 1:4000), HA-HRP (Roche, ♯11867423001; 1:2000), IP₃R1 (Thermo Fischer, ♯PA1-901; 1:1000), IP₃R1 & IP₃R2 [previously described⁷⁷; 1:1000], IP₃R3 (BD Biosciences, ♯610312; 1:1000), KDEL (AbCam, ♯ab12223; 1:2000), MCL-1 (Cell Signaling Technology, ♯5453; 1:1000), Nicastrin (BD Biosciences, ♯612290; 1:1000), PARP (Cell Signaling Technology, ♯9542; 1:1000), SERCA2 (Cell Signaling Technology, ♯4388; 1:1000), STIM1 (Cell Signaling Technology, ♯5668; 1:1000).
For immunofluorescence: DAPI (Thermo Fischer, ♯D1306; 1 µg/ml), HA (Cell Signaling Technology, ♯3724; 1:500), BAP31 (Enzo Life Sciences, ♯ALX-804-601-C100; 1:250).
For proximity ligation assay: HA (Cell Signaling Technology, ♯3724; 1:500), HA (Enzo Life Sciences, ♯ENZ-ABS118-0200; 1:200), IP₃R1 (Thermo Fischer, ♯PA1-901; 1:200), IP₃R3 (BD Biosciences, ♯610312; 1:200).

Dulloo I., Atakpa-Adaji P., Yeh Y.C., Levet C., Muliyil S., Lu F., Taylor C.W, & Freeman M. (2022). iRhom pseudoproteases regulate ER stress-induced cell death through IP3 receptors and BCL-2. Nature Communications, 13, 1257.

+ Open protocol

+ Expand

Western Blot Analysis of Cardiac Proteins

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot analysis was performed as we described previously [39 (link)–42 (link)]. Protein samples of the cardiomyocytes and fibroblasts isolated from the mouse hearts were prepared in RIPA lysis buffer. 30μg of total proteins were resolved by SDS-PAGE and transferred to a nitrocellulose membrane (Bio-Rad). Then the membranes were incubated overnight (4°C) with a primary antibody against AC4 (Sigma, SAB4300752, 1:1000), PKA (Cell Signaling, #5842, 1:1000), P-PKA (Cell Signaling, #5661, 1:1000), PLN (Cell Signaling, #14562, 1:1000), P-PLN (Cell Signaling, #8496, 1:1000), SERCA2 (Cell Signaling, #9580, 1:1000), Cleaved-caspase 3 (Cell Signaling, #9661, 1:1000), Epac1 (Abcam, ab109415, 1:1000), GAPDH (Santa Cruz, sc-32233, 1:1000). Goat anti-mouse or goat anti-rabbit horseradish peroxidase (1:2000–1:5,000; Santa Cruz Biotechnology) was used as a secondary antibody and incubated for 1 hour at room temperature. Specific proteins were detected by chemiluminescent methods using Clarity^™ western ECL substrate (Bio-Rad, Hercules, CA). Protein abundance on western blots was quantified by densitometry using Image lab software (Bio-Rad, Hercules, CA).

Chen K., Wang S, & Sun Z. (2022). In Vivo Cardiac-specific Expression of Adenylyl Cyclase 4 Gene Protects against Klotho Deficiency-induced Heart Failure. Translational research : the journal of laboratory and clinical medicine, 244, 101-113.

+ Open protocol

+ Expand

Cardiac Protein Interaction Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pull-down assays were performed as previously described [25 (link),56 (link)]. Briefly, wild-type mouse cardiac homogenates were prepared in 10 mM NaPO₄ (pH 7.2), 2 mM EDTA, 10 mM NaN₃, 120 mM NaCl, and 1% NP-40, supplemented with protease inhibitors (Sigma-Aldrich, Munich, Germany). Equivalent amounts of recombinant GST-PLN-WT and GST-PLN-R14del recombinant proteins were mixed with 0.5 mg of mouse cardiac homogenates at 4 °C for 16 h. The beads were washed with 10 mM NaPO₄ (pH 7.2), 10 mM NaN₃, 120 mM NaCl, and 0.1% (v/v) Tween-20 and were subsequently analyzed by Western blot with the following primary antibodies: SERCA2, Hsp90 (Cell Signaling Technology, Leiden, The Netherlands), HAX-1 (BD Biosciences, Erembodegem, Belgium), PP1, GM (Santa Cruz Biotechnology, Heidelberg, Germany), Hsp20, I-1 (AbCam, Cambridge, UK), HRC (Sigma-Aldrich, Munich, Germany), and peroxidase-conjugated goat anti-rabbit (GE Healthcare Life Sciences, Buckinghamshire, UK) or anti-mouse (Sigma-Aldrich, Munich, Germany) secondary antibodies. Immunoreactive bands were detected using Pierce ECL Plus reagents (ThermoFisher Scientific, Waltham, MA, USA). Protein quantification was performed using ImageJ [57 (link)].

Vafiadaki E., Haghighi K., Arvanitis D.A., Kranias E.G, & Sanoudou D. (2022). Aberrant PLN-R14del Protein Interactions Intensify SERCA2a Inhibition, Driving Impaired Ca2+ Handling and Arrhythmogenesis. International Journal of Molecular Sciences, 23(13), 6947.

+ Open protocol

+ Expand

Immunoprecipitation Protocol for Transfected HEK 293 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoprecipitation experiments in transiently transfected HEK 293 cells were performed as previously described [30 (link),47 (link)]. Briefly, forty-eight hours after transfection, cells were lysed in 50 mM Tris HCl, 150 mM NaCl, and 1% NP40 supplemented with protease inhibitors. Pre-cleared protein extracts were incubated overnight on a rotary wheel at 4 °C with the GFP antibody (Sigma-Aldrich, Munich, Germany, Erembodegem, Belgium) and protein-A/G agarose beads (Santa Cruz Biotechnology, Heidelberg, Germany). Immunoprecipitates were collected by a 5 min spin at 2000 rpm, washed three times in PBS, and analyzed by Western blot analysis using SERCA2 (Cell Signaling Technology, Leiden, The Netherlands) or GFP (Sigma-Aldrich, Munich, Germany) antibodies.

+ Open protocol

+ Expand

Protein Expression Detection Methods

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression of proteins were detected using antibodies against mouse lamin A/C (SAB4200236, Sigma‐Aldrich, St. Louis, MO, USA), human lamin A (MAB3540, Millipore, Burlington, MA, USA), Sarcolipin (ABT13, Millipore), β‐tubulin (ab179513, Abcam, Cambridge, UK), FLAG (F7425, Sigma‐Aldrich), HA (H6908, Sigma‐Aldrich), lamin B1 (ab133741, Abcam), lamin B (sc‐6217, Santa Cruz, Dallas, TX, USA), Calnexin (MAB3126, Millipore), Calreticulin (PA3‐900, Thermo Fisher Scientific), SERCA2 (4388, Cell Signaling, Danvers, MA, USA), β‐ACTIN (A5441, Sigma‐Aldrich), Grp78 (ab108613, Abcam), Chop (2891, Cell Signaling), eIF2α (2103, Cell Signaling), phospho‐eIF2α (3398, Cell Signaling), Atf4 (SC‐200, Santa Cruz), IRE1α (3294, Cell Signaling), phospho‐IRE1α (PA1‐16927, Thermo Fisher Scientific), and Gapdh (GTX100118, GeneTex, Hsinchu, Taiwan).

Wang W., Wang J., Lin W., Kao C., Hung M., Teng Y., Tsai T, & Chi Y. (2019). Progerin in muscle leads to thermogenic and metabolic defects via impaired calcium homeostasis. Aging Cell, 19(2), e13090.

+ Open protocol

+ Expand

TMEM203 Regulation of NFAT2 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

TMEM203; D1ER, NFAT2 (1–402) were synthesized and cloned into desired plasmids by Genscript USA Inc. pTUNE-TMEM203, RFP-fused organelle markers were purchased from OriGene Technologies Inc. Various antibodies were purchased from respective companies as mentioned—STIM1 (Cat # 4916) and SERCA2 (Cat # 4388) from Cell signaling technologies. IP3R antibody (# 610312) from BD Bioscience, INSIG1 (Cat #ab70781) from Abcam and M2 FLAG from Sigma Aldrich. siRNA against Human TMEM203 were from Qiagen—siRNA TMEM203—CAGGCACTGCTTGGCTTACTA (Cat #-SI00633185); control siRNA were purchased from Dharmacon-Thermo Scientific—Non-Targeting siRNA #1(Cat #-D-001210-01-05).

Shambharkar P.B., Bittinger M., Latario B., Xiong Z., Bandyopadhyay S., Davis V., Lin V., Yang Y., Valdez R, & Labow M.A. (2015). TMEM203 Is a Novel Regulator of Intracellular Calcium Homeostasis and Is Required for Spermatogenesis. PLoS ONE, 10(5), e0127480.

+ Open protocol

+ Expand

Cardiac Calcium Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Caffeine was obtained from Sigma. Phospho-RyR2 (S2809) (1:1000), phospho-SERCA2 (S38) were obtained from Badrilla. RyR2 (1:1000), SERCA2 (1:1000), phospho-PLN (1:1000), and PLN (1:1000) antibodies were obtained from Cell Signaling Technology. PI3Kγ (1:1000) and PP1 (1:1000) antibodies were from Santacruz Biotechnology. PP2Ac (1:2000) antibody was obtained from Millipore. Okadaic Acid was obtained from Sigma.

Mohan M.L., Witherow C.P., Papay R.S., Sun Y., Stenson K., & Prasad S.V.N. (2021). Kinase independent function of PI3Kγ modulates calcium re-uptake by regulating phospholamban function.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!