Microrna reverse transcription kit

miR-145 purification kit was purchased from EZ Bioscience, Beijing, China and the cDNA of miR-145 were extracted by microRNA Reverse Transcription Kit (EZ Bioscience, Carlsbad, USA). The amplification of miR-145 was carried out by 2× qPCR Mix for microRNA (EZ Bioscience, Carlsbad, USA). GAPDH was used to normalized the expression of miR-145. The primers listed as below:
U6:
forward primer: CTCGCTTCGGCAGCACA.
reverse primer: AACGCTTCACGAATTTGCGT.
miR145: forward primer: GTCCAGTTTTCCCAGGAA.
reverse primer:CAGGTCAAAAGGGTCCTT.
GABARAPL1: forward primer: ATGAAGTTCCAGTACAAGGAGGA.
Reverse primer: GCTTTTGGAGCCTTCTCTACAAT.

Total RNAs were isolated from PDLSCs using EZ-press RNA Purification Kit (EZBioscience, USA), mRNAs were reverse-transcribed into cDNAs by the Color Reverse Transcription Kit (EZBioscience, Roseville, USA) and the cDNAs of miRNAs were acquired with the microRNA Reverse Transcription Kit (EZBioscience, Roseville, USA). 2×Color SYBR Green qPCR Master Mix (for mRNA) and EZ-Probe qPCR Master Mix for microRNA (EZBioscience, Roseville, USA) were used for subsequent qRT-PCR amplification on ABI Quant-Studio 5 system. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 were used as internal controls. The sequences of the gene-specific primers are listed in Table 1. Universal 3'qPCR primer is included in EZ-Probe qPCR Master Mix for microRNA (EZBioscience, Roseville, USA).Table 1

Primer sequences for quantitative reverse-transcription polymerase chain reaction

Gene	Sequence 5′ → 3′
SMAD6	Forward: AGACGGCGTTGGCCTTT
	Reverse: CCTGCCTTTACCTTGCCTTTT
LOC100302640	Forward: GCGGAAGGGGCTTGTTCATT
	Reverse: TGCGTAGGTCAAGTATCGGC
miR-1469	Forward: CTCGGTGCGGGGCG
U6	Forward: CCTGCTTCGGCAGCACA
GAPDH	Forward: AACGGATTTGGTCGTATTGGG
	Reverse: CCTGGAAGATGGTGATGGGAT

Abbreviations: GAPDH, Glyceraldehyde-3-phosphate dehydrogenas; SMAD6, Mothers against decapentaplegic homolog 6.

Total RNA from NSCs and hippocampal tissue samples was extracted employing Trizol reagent (Invitrogen, Carlsbad, CA), and miRNAs from cells and hippocampal tissue samples were extracted utilizing miRNA extraction kit (19331ES08, MolPure ® Cell/Tissue miRNA Kit, Yeasen, Shanghai, China). The extracted RNA was reversely transcribed into complementary DNA (cDNA) from 500 ng of RNA by referring to the PrimeScript RT reagent Kit (RR047A, Takara, Japan). miRNA was reversely transcribed into cDNA utilizing microRNA Reverse Transcription Kit (EZBioscience, EZB-Exo-RN1). The synthesized cDNA was subjected to RT-qPCR with the Fast SYBR Green PCR kit (4364344, Applied biosystems, Foster City, CA) and the ABI PRISM7300 RT-qPCR system (Applied biosystems). GAPDH served as a normalizer for mRNA, and U6 for miRNA. The relative expression of genes or mRNAs was analyzed employing the 2^-ΔΔCt method. Primers are described in Table S1.

TRIzol reagent was used to extract total RNA from the tissue or cell line according to the manufacturer's instructions. For circRNA and mRNA, the PrimeScript RT reagent Kit (Takara, Japan) was used to synthesize total RNA into cDNA, and TB Green Premix Ex Taq II (Takara, Japan) was used for cDNA amplification. For miRNA, the microRNA Reverse Transcription Kit (EZBioscience, USA) was used for reverse transcription, and Probe qPCR Master Mix for microRNA (EZBioscience, USA) was used for cDNA expansion. β-Actin, GAPDH and U6 were used as internal controls. The expression of each gene was normalized to that of the internal control and quantified using the 2^−ΔΔCT method. Related primer sequences are shown in Additional file 1: Table S1.

Total RNA was extracted by TRIzol reagent (15,596,026, Invitrogen). RNA integrity was characterized utilizing agarose gel electrophoresis (1%), and RNA concentration and purity were measured utilizing ND-1000 spectrophotometer. Based on protocols of PrimeScript RT reagent Kit (RR047A, Takara, Dalian, China), RNA was reverse-transcribed into cDNA in a 20 μL reaction system. For miR-642b-3p and U6 detection, RNA was reverse-transcribed into cDNA using microRNA Reverse Transcription Kit (EZ Bioscience, EZB-miRT2-S). The primers for miR-642b-3p, Smad7, Smad4, CSMD1, alpha smooth muscle actin (α-SMA), fibronectin (FN), matrix metallopeptidase (MMP)-2, MMP-9, U6, and GAPDH were synthesized commercially (Sangon, Shanghai, China), as shown in Supplementary Table 1. qRT-PCR was performed following protocols of SYBR® Premix Ex Taq^TM II kit (TaKaRa) and ABI 7500 PCR system (Applied Biosystems, Foster City, CA). The relative expression of target genes was calculated based on the 2^−ΔΔCt method [23 (link)], with U6 and GAPDH serving as housekeeper genes.

Total RNAs were isolated by the TRIzol reagent (Invitrogen, USA) and determined by the NanoDrop 1000 instrument (Nanodrop Technologies, USA). 1 μg of total RNAs was used for reverse transcription by HiScript III RT SuperMix (Vazyme, China) and mRNAs were quantified by qRT-PCR assays using ChamQ Universal SYBR qPCR Master Mix Kit (Vazyme, China). tRF-RNAs were extended the 3’ end through Poly(A) addition using Poly(A) Polymerase in reverse transcription reaction (microRNA Reverse Transcription Kit, EZBioscience, USA) and then quantified by probe based real-time qRT-PCR using EZ-Probe qPCR Master Mix for microRNA (ROX2 plus) Kit (EZBioscience, USA). The sequence-specific forward primers of tRF-RNAs were as follows: tRF-22: 5’-GGGTCAAATCTCGGTGGAAC-3’, U6: 5’-CCTGCTTCGGCAGCACA-3’. The probes and reverse primers were included in the EZ-Probe qPCR Master Mix for microRNA (ROX2 plus) Kit. The primers of mRNAs were exhibited in Additional file 1: Table S1. Each reaction was performed at least in triplicate and the 2^−∆∆Ct method was used for quantitative analysis.