RNA was extracted from the left tibiae by crushing them in liquid nitrogen and collecting the bone powder in Trifast (Peqlab, Erlangen, Germany). The mononuclear cell fraction was lysed in Trifast (Peqlab). RNA from both C2C12 cells and MC3T3-E1 cells was isolated using Trifast (Peqlab) after washing twice with PBS. RNA isolation was performed according to the manufacturer's protocol. Five hundred nanograms (500 ng) of RNA was reverse-transcribed using Superscript II (Invitrogen, Darmstadt, Germany) and subsequently used for SYBR green-based real-time PCR reactions using a standard protocol (Applied Biosystems, Carlsbad, CA, USA). Primer sequences are summarized in Table 1 . Complementary DNA (cDNA) was synthesized, and qRT-PCR was performed on a Stratagene Mx3005P QPCR System (La Jolla, CA, USA). PCR results were analyzed using Opticon Monitor Analysis 2.0 software (Bio-Rad Laboratories, Hercules, CA, USA). Relative mRNA expression was quantified by subtracting the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) threshold cycle (Ct) value from Ct value of the genes of interest and expressed as 2−ΔΔCt, as described by the protocol of the manufacturer.
Trifast
Manufactured by Avantor
Sourced in Germany, United States
TriFast is a reagent system designed for the isolation of high-quality RNA from a wide range of sample types. It is a single-step, phenol-free method that enables efficient and reproducible RNA extraction.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (11 mentions)
Superscript 2, by Thermo Fisher Scientific (7 mentions)
Dnase 1, by New England Biolabs (6 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Peqgold total rna kit, by Avantor (5 mentions)
Sybr green, by Thermo Fisher Scientific (4 mentions)
Beadbug 6 homogenizer, by Biozym (4 mentions)
Taqman fast universal pcr master mix for taqman assays, by Thermo Fisher Scientific (4 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Gotaq qpcr master mix, by Promega (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Quantitect, by Qiagen (3 mentions)
Cfx manager 3, by Bio-Rad (3 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Qiaamp viral rna mini kit, by Qiagen (3 mentions)
Cfx96 real time system, by Bio-Rad (3 mentions)
Dnase 1, by Thermo Fisher Scientific (3 mentions)
115 protocols using trifast
1
RNA Isolation and qRT-PCR Analysis
2
RNA Extraction from Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After removal of the cell culture supernatant, 500 µl of TriFast (Peqlab) or RNA-solv (VWR) were added to the dish. Cells were detached via gentle pipetting and transferred to RNAse-free microcentrifuge tubes. The tubes were vortexed for 15 s at maximum speed and stored at -80°C until RNA extraction. RNA extraction was performed according to the manufacturer’s protocol (Peqgold TriFast™ or VWR RNA-solv®). To maximize RNA yield, 2 µl of Pelletpaint (Merck Millipore) or 1.5 µl Glycoblue coprecipitant (Thermo Fisher) were added to the samples in the isopropanol precipitation step. A switch to RNA-solv and Glycoblue coprecipitant was necessary due to a shortage of supply and discontinuation of TriFast.
3
miRNA Extraction and Normalization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two different approaches were performed to measure the miRNA expression in tissue and blood serum. The whole RNA was isolated from the tissues using a phenol-chloroform method (TriFast, PeqLab, Erlangen, Germany). Following the manufacturer’s protocol, samples were first homogenized, then chloroform was added. After centrifugation, three phases were visible and the RNA-containing upper phase was used for further processing. Isopropanol was added to precipitate the RNA, which was pelleted and washed. After resuspension in ultra-pure water, concentration and purity were measured using the nanodrop (PeqLab, Erlangen, Germany). Samples were used only when the quality ratios of A260/A280 were higher than 1.9 and A260/A280 were higher than 2.1.
The same amount of serum from all animals was used for serum isolation. A spike-in approach was adopted for serum isolation using cel-miR-39 (UCACCGGGUGUAAAUCAGCUUG, Thermo Fisher Scientific, Waltham, MA, USA) which was added to the samples before RNA isolation. First, the serum samples were supplemented with TriFast (PeqLab, Erlangen, Germany); then, the cel-miR-39 was added in the final concentration of 28 pmol per sample. After adding chloroform, the RNA-containing upper phase was used to isolate the RNA described above. Finally, after the cel-miR-39 was detected in all serum samples, it was used for normalization.
The same amount of serum from all animals was used for serum isolation. A spike-in approach was adopted for serum isolation using cel-miR-39 (UCACCGGGUGUAAAUCAGCUUG, Thermo Fisher Scientific, Waltham, MA, USA) which was added to the samples before RNA isolation. First, the serum samples were supplemented with TriFast (PeqLab, Erlangen, Germany); then, the cel-miR-39 was added in the final concentration of 28 pmol per sample. After adding chloroform, the RNA-containing upper phase was used to isolate the RNA described above. Finally, after the cel-miR-39 was detected in all serum samples, it was used for normalization.
4
Chicken Tissue Protein and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal procedures were approved by the Animal Care and Use Committee of the Medical University of Vienna (66.016/0014-II/3b/2011), and all these procedures were conducted according to the guidelines established by this committee. Fertilized chicken eggs were incubated according to published protocols (Eresheim et al. 2014 (link)). Hatched chickens were obtained by Schropper GmbH, Gloggnitz, Austria. Chickens were decapitated at embryonal development day 18 or on the first day after hatching. Tissue samples for protein analysis were frozen immediately at −20 °C until further processing. Proteins were extracted with Laemmli extraction buffer containing 2% SDS by homogenization with the Precellys system (VWR International, Radnor, PA). Protein concentrations were determined with the Micro BCA protein assay kit (Thermo Fisher Scientific). For analyses of RNA, samples from different chicken tissues were cut into small pieces and kept in TriFast (VWR International) at 4 °C overnight. RNA was purified using the Precellys system (VWR International, Radnor, PA) and TriFast according to the manufacturers’ instructions.
5
Total RNA Extraction from Pig Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue aliquots were taken by authorized veterinarians after slaughter during the mandatory controls planned for the pig breeding sector; therefore, no ethical approval was required. Total RNA extraction was performed from the collected tissues for the genetic analysis of the host and from meat juice for the detection of viral RNA. In order to collect the meat juice, the tissue samples were initially frozen at −20 °C. At the time of analysis, the samples were allowed to thaw and were centrifuged at 4000 rpm for 10 min. Total RNA extraction was performed from about 80 mg of each collected tissue homogenized in 1 mL of Trifast (VWR company®, Avantor, Radnor Township, PA, USA), by TissueLyser II (Qiagen®, Hilden, Germany), with two steps at 20.0 Hz for 3′. After the homogenization phase, the RNA was purified, precipitated, and washed following the manufacturer’s instructions for the Trifast reagent (VWR company®, Avantor). The extracted RNA was resuspended in 50 μL of nuclease free water. Similarly, RNA was extracted from 250 µL of meat juice in 750 µL of Trifast®, with the same protocol used for the tissues described above, without the homogenization step. The RNAs’ quantity and quality were estimated photometrically with a Biophotometer (Eppendorf®, Hamburg, Germany).
6
Macrophage Phenotyping via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For further macrophage phenotyping, qPCR analyses were carried out. Total RNA from macrophage cultures was isolated using TriFast (peqlab, Darmstadt, Germany) and phenol-chloroform extraction, and 0.5 μg RNA was transcribed into cDNA using a reverse transcription kit by Qiagen (QuantiTect®, Hilden, Germany) by following the manufacturer's recommendations. qPCR then was conducted with a Thermo Scientific (Waltham, MA, USA) SYBR Green kit. Normalization of qPCR measurements was performed using two housekeepers (Table 2 ). Bio-Rad primers (Table 2 , Bio-Rad Laboratories, Inc., Hercules, CA, USA) were used according to the manufacturer's instructions.
7
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated with Trifast (Peqlab), cDNA was transcribed using a cDNA synthesis kit (Applied Biosystems). Expression levels of the housekeeping genes hypoxanthine-guanin-phosphoribosyltransferase (Hprt, mouse) or cyclophilin A (PPIA, human), as of the genes of interest, were analyzed using primer/probe combinations selected from the Roche Universal Probe Library (Roche). For human MINCLE, the primer/probe combination was selected using the software PrimerExpress (Applied Biosystems). All primers and probes used have been described (28 (link)) and were purchased from Metabion. ΔCT values were calculated as ΔCT = CT(housekeeping gene) − CT(gene of interest) (such that higher values indicate higher relative expression), and ΔΔCT values referred to the calibrator as indicated.
8
Protein and miRNA Extraction and Analysis
9
Renal Cancer Cell Line Cultivation and Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Renal cancer cell lines CaKi-1, CaKi-2, Cal-54, and A-498 were cultured in RPMI1640 medium supplemented with 10% fetal bovine serum, 1% stable glutamine, and 1% penicillin/streptomycin solutions (PAA Laboratories, Pasching, Austria) at 37 °C with 5% CO2 in humidified air [17 (link)]. Sub-confluent cells were treated with IFN-γ (10 ng/mL from R&D Systems, Minneapolis, MN, USA) for 24 h. RNA extraction was performed with Trifast (Peqlab, Erlangen, Germany) according to the manufacturers’ protocol. Protein extraction was performed with RIPA buffer (Cell Signalling Technology Europe, Frankfurt a.M., Germany) supplemented with protease inhibitor cocktail (Sigma-Aldrich Chemie, Munich, Germany) and phosphatase blocker (Phos-STOP, Roche Diagnostics, Mannheim, Germany). Extraction procedure was according to the manufacturers’ protocols. The cell lines were from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany, and were recently authenticated using DNA profiling with highly polymorphic short-tandem repeats (STR) loci. All experiments were performed with tested mycoplasma-free cells (Minerva Biolabs GmbH, Berlin, Germany) and analyses were performed three times.
10
Viral Diagnostic Protocol Database for ENIVD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Within the European Network for Diagnostics of Imported Viral Diseases (ENIVD) we gathered a wide range of emerging viruses, as inactivated culture supernatants or as purified viral DNA or RNA (Table 1 ). Viruses were inactivated by heat and/or gamma-irradiation, or by suspension in an RNA-extraction reagent (TRIzol, Life Technologies; TriFast, Peqlab; AVL buffer, Qiagen) [27] (link). The majority of viruses were grown in Vero E6 cell-cultures (kidney epithelial cell line derived from African green gonkey) (ATCC CRL-1586), but poliovirus (PV) was grown in L20B cells (a murine recombinant cell line) [28] (link). We also used six control samples from the QCMD EQA programme for 2010 and 2013 (WNV10-01, WNV10-07, WNV13-01, WNV13-10, WNV13-11 and DENV13-01). The WNV13-01 sample contained West Nile virus (WNV) at a concentration of 1.0×107 copies/ml and the DENV13-01 sample contained Dengue virus (DENV) type 1 at a concentration of 1.0×106 copies/ml. The WNV10-01 and WNV13-10 samples contained a mixture of flaviviruses (DENV type 1, 2 and 4, and Japanese encephalitis virus (JEV)). The WNV10-07 and WNV13-11 samples contained a mixture of DENV type 3, tick-borne encephalitis virus (TBEV) and yellow fever virus (YFV), each at a concentration of 1.0×106 copies/ml.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!