Rneasy cleanup kit

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom

The RNeasy cleanup kit is a product designed for the purification of RNA. It facilitates the removal of contaminants and inhibitors from RNA samples, allowing for the recovery of high-quality RNA suitable for various downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

90 protocols using rneasy cleanup kit

RNA Extraction from Human and Rat Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs from Human and rats PAs were isolated by using Trizol-Reagent (Applygen, China). The tissue samples were homogenized in 10 ml Trizol reagent. Phase separation of RNA was performed by adding one-tenth volume of chloroform, vortex mixing for 15 s, and centrifuged at 12,000 × g for 10 min. Isopropyl alcohol (0.5 ml/1 ml Trizol) was added to the aqueous phase to precipitate total RNA. Precipitate was washed twice with 75% ethanol. For Affymetrix analysis, the RNA sample was dried and then re-dissolved. RNA quality was determined by the ratio of absorbance at 260–280 nm (A260/A280). All extracted RNA was further purified using RNeasy Clean Up kit (Qiagen) to increase A260/A280 readings.

Fan F., Tian H., Geng J., Deng J., Liu Y., Chen C., Zhang S., Zhang Y., Li J., Tian H., Dart A.M, & Zou Y. (2019). Mechanism of Beraprost Effects on Pulmonary Hypertension: Contribution of Cross-Binding to PGE2 Receptor 4 and Modulation of O2 Sensitive Voltage-Gated K+ Channels. Frontiers in Pharmacology, 9, 1518.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using standard Trizol® (Sigma Aldrich, Dorset, UK) extraction method [31] (link) and purified using RNeasy clean-up kit (Qiagen); cDNA was synthesised using iScript first strand kit from 1 μg of isolated RNA (Bio-Rad, Hercules, USA). Primers were designed for the following genes: CCL2 (5′-TGAATGTGAAGTTGACCCGT-3′; 5′-TTAAGGCATCACAGTCCGAG-3′), CCL5 (5′-GTGCCCACGTCAAGGAGTAT-3′; 5′-CCCACTTCTTCTCTGGGTTG-3′), CXCL1 (5′-CTTGAAGGTGTTGCCCTCAG-3′; 5′-TCTCCGTTACTTGGGGACAC-3′), IL-6 (5′-AGGTGCTAAAGGGTCTCTTG-3′; 5′-TCCACGATTTCCCAGAGAAC-3′), S29 (5′-ATGGGTCACCAGCAGCTCTA-3′; 5′-GTATTTGCGGATCAGACCGA-3′). Targets were amplified from 1 μg of cDNA using SYBR Green master mix reagent and amplified using a Bio-Rad thermocycler (Bio-Rad icycler, Heracles, USA). The threshold cycle for target genes of interest was normalised to s29 and expressed as fold-change using the delta-delta ct (2^−ΔΔct) method.

Lightfoot A.P., Sakellariou G.K., Nye G.A., McArdle F., Jackson M.J., Griffiths R.D, & McArdle A. (2015). SS-31 attenuates TNF-α induced cytokine release from C2C12 myotubes. Redox Biology, 6, 253-259.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis for Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from WT and mutant fully elongated stems (45 DAG) with EZ-10 Spin column Plant RNA Miniprep Kit following the guidelines of Biobasic (canada). Forty μl were treated with DNAse1 (New England Biolabs, USA) during 1 h. RNA there then purified with RNeasy Clean Up kit, Qiagen (Germany) and eluted in final 15 μl. RNA concentration was estimated with Epoch spectrophometer, BioTek (USA). cDNAs were produced from 500 ng of RNA with Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland), and anchored oligo d(T). cDNAs were diluted 1/10 before use. Semi quantitative PCR were run on 1 μl of cDNA. Transcrit cDNAs were with amplified with Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs, USA) according to the manufacturer instructions. We used the same melting hybridization (60 °C) and elongation time (10 s) with 25 to 30 cycles according to the gene of interest. Genes of interests were amplified with the following primers: ERECTA-1/Bradi1g46450fw: ATGGCGACGACGGCGGCGGCGTCCG, Bradi1g46450rev: CAATCTCATCAGGGATCTGGCCGGTAAGCCC; House keeping gene (Bradi5g14640) /SamDCfw: CGGCAAGCTTGCTAATCTGCTCCAAT and SamDCrev: CAGAGCAACAATAGCCTGGCTGGC.

Sakai K., Citerne S., Antelme S., Le Bris P., Daniel S., Bouder A., D’Orlando A., Cartwright A., Tellier F., Pateyron S., Delannoy E., Laudencia-Chingcuanco D., Mouille G., Palauqui J.C., Vogel J, & Sibout R. (2021). BdERECTA controls vasculature patterning and phloem-xylem organization in Brachypodium distachyon. BMC Plant Biology, 21, 196.

+ Open protocol

+ Expand

Btn1a1 Gene Expression in Lactating Mammary Glands

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT‐PCR, total RNA from day 5 lactating mammary glands was prepared from six each, Btn1a1^+/+and Btn1a1^−/− mice using TRIzol reagent (Invitrogen) and the isolated RNA purified using a Qiagen RNeasy cleanup kit (Valencia, CA). For RNAseq, total RNA was isolated from the mammary glands of five Btn1a1^+/+ and seven Btn1a1^−/− mice (days 9–11 of lactation) using Tri Reagent® and an associated kit from Zymo Research Corp (Irvine, CA). In all cases, samples were stored immediately after isolation in RNase‐free water at −80°C.

Jeong J., Kadegowda A.K., Meyer T.J., Jenkins L.M., Dinan J.C., Wysolmerski J.J., Weigert R, & Mather I.H. (2021). The butyrophilin 1a1 knockout mouse revisited: Ablation of Btn1a1 leads to concurrent cell death and renewal in the mammary epithelium during lactation. FASEB BioAdvances, 3(12), 971-997.

+ Open protocol

+ Expand

Total RNA Extraction from Corneal Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA isolated using TRI Reagent from ex vivo corneal endothelium and cultured pHCEnC was purified using the RNeasy Clean-Up Kit (Qiagen). The integrity of the purified RNA was analyzed by the Agilent 2100 Electrophoresis Bioanalyzer System (Agilent Technologies, Inc., Santa Clara, CA, USA).

Chung D.D., Frausto R.F., Lin B.R., Hanser E.M., Cohen Z, & Aldave A.J. (2017). Transcriptomic Profiling of Posterior Polymorphous Corneal Dystrophy. Investigative Ophthalmology & Visual Science, 58(7), 3202-3214.

+ Open protocol

+ Expand

Transcriptome Analysis of Cultured Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cultured keratinocytes at each passage and subsequently purified with the RNeasy Clean‐Up Kit (Qiagen, Valencia, CA, USA). TruSeq Stranded mRNA Sample Prep kit (Illumina, San Diego, CA) was used for the library preparation following the manufacturer's instructions, starting with 1–2 μg of RNA. The poly‐A mRNA was fragmented for 3 min at 94°C and purification performed by using 1X Agencourt AMPure XP beads. Both RNA samples and final libraries were quantified by using the Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) and quality tested by Agilent 2100 Bioanalyzer RNA Nano assay (Agilent technologies, Santa Clara, CA). Libraries were then processed with Illumina cBot for cluster generation on the flowcell, following the manufacturer's instructions and sequenced on single‐end (or paired‐end, if required) mode at the multiplexing level requested on HiSeq2500 (Illumina, San Diego, CA). The CASAVA 1.8.2 version of the Illumina pipeline was used to process raw data for both format conversion and de‐multiplexing.

Barbaro V., Orvieto A., Alvisi G., Bertolin M., Bonelli F., Liehr T., Harutyunyan T., Kankel S., Joksic G., Ferrari S., Daniele E., Ponzin D., Bettio D., Salviati L, & Di Iorio E. (2022). Analysis and pharmacological modulation of senescence in human epithelial stem cells. Journal of Cellular and Molecular Medicine, 26(14), 3977-3994.

+ Open protocol

+ Expand

Extracellular Vesicle miRNA Extraction from Follicular Fluid

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Follicular fluid (otherwise discarded material) was collected during oocyte retrieval from follicles >18 mm, centrifuged at 1500×g for 15 min. Samples were pre-cleaned using a 0.80 um pore-size polyethersulfone filter (StericupRVP, Merck Millipore) to remove larger proteins and debris and aliquoted into 500 uL for immediate storage at −80°C (Witwer et al. 2013 ). Only mature (MII) oocytes were examined for RNA analysis. Methods for RNA extraction from biological fluids have been previously described (Pergoli et al. 2017 (link)). In short, samples were thawed, centrifuged for 15 min at 1200 × g at room temperature and then centrifuged three times at 1000, 2000, and 3000 × g, respectively, for 15 min at 4°C Following this steps, samples were ultracentrifuged (Beckman Coulter Optima-MAX-XP) at 110,000 × g for 75 min at 4°Cfor the extraction of EV, as ultracentrifugation is considered the standard according to International Society for Extracellular Vesicle recommendations (Gardiner et al. 2016 (link)). The pellets obtained were kept at −80°C until use. EV-miRNAs were extracted from the ultracentrifuged pellets using the miRNAeasy Kit and RNeasy CleanUp Kit per the manufacturer (Qiagen, Valencia, CA, USA). The final purified EV-miRNA-enriched RNA was eluted into 20 uL of RNAse-free water and stored at −80°C until further use.

Martinez R.M., Hauser R., Liang L., Mansur A., Adir M., Dioni L., Racowsky C., Bollati V., Baccarelli A.A, & Machtinger R. (2018). Urinary concentrations of phenols and phthalate metabolites reflect extracellular vesicle microRNA expression in follicular fluid. Environment international, 123, 20-28.

+ Open protocol

+ Expand

EV-miRNA Extraction and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare the EV pellets for miRNA extraction, supernatant was ultracentrifuged (Beckman Coulter Optima-MAX-XP) at 110,000× g for 4 h, at 4 °C and decanted. The EV pellet was stored at −80 °C until use. Isolation of miRNAs from EVs was performed with the combination of miRNeasy kit and RNeasy Cleanup Kit (Qiagen), according to the manufacturer’s protocol. miRNAs were eluted in 20 µL of Nuclease-Free Water and stored at −80 °C, until use. miRNAs reverse transcription (RT) and preamplification reactions, followed by real-time RT-PCR analysis with the QuantStudio™ 12K Flex OpenArray^® Platform (Applied Biosystems, Milan, Italy), were previously described. Gene Expression Suite Software (Applied Biosystems) was used to process miRNA expression data from the “TaqMan™ OpenArray™ Human MicroRNA panel” (ThermoFisher) analysis.
To elucidate the possible role of the EV-miRNAs, we performed a miRNA target analysis using SpidermiR by R software (v 4.0.4). Then, we compared genes obtained by the miRNA target analysis, with genes associated with atherosclerosis and inflammation downloaded from DisGeNET v 7.0. In addition, for each miRNA, we performed an enrichment analysis [79 (link)].

Greco M.F., Rizzuto A.S., Zarà M., Cafora M., Favero C., Solazzo G., Giusti I., Adorni M.P., Zimetti F., Dolo V., Banfi C., Ferri N., Sirtori C.R., Corsini A., Barbieri S.S., Pistocchi A., Bollati V., Macchi C, & Ruscica M. (2022). PCSK9 Confers Inflammatory Properties to Extracellular Vesicles Released by Vascular Smooth Muscle Cells. International Journal of Molecular Sciences, 23(21), 13065.

+ Open protocol

+ Expand

miRNA Profiling of Adipose-Derived EV

Check if the same lab product or an alternative is used in the 5 most similar protocols

EVs from three independent population of ASCs were collected and pellets stored at − 80 °C. miRNAs were isolated from frozen EV pellets by using the miRNeasy Kit and RNeasy CleanUp Kit (Qiagen, Hilden, Germany). miRNAs were prepared by standard reverse transcription (RT) and preamplification procedures, followed by real-time RT-PCR analysis with the QuantStudio™ 12 K Flex OpenArray® Platform (QS12KFlex) as previously described [29 ]. Gene Expression Suite Software (Life Technologies) was used to process miRNA expression data from the miRNA panel. After data cleaning, 267 miRNAs with C_RT value < 27 and AmpScore > 1.1 were selected since amplified in all ASC-EVs under analysis. The global mean was selected as normalization method due to the high correlation between samples [30 ]. miRNA expression was determined using the relative quantification 2^−ΔCRT.

Ragni E., Perucca Orfei C., De Luca P., Lugano G., Viganò M., Colombini A., Valli F., Zacchetti D., Bollati V, & de Girolamo L. (2019). Interaction with hyaluronan matrix and miRNA cargo as contributors for in vitro potential of mesenchymal stem cell-derived extracellular vesicles in a model of human osteoarthritic synoviocytes. Stem Cell Research & Therapy, 10, 109.

+ Open protocol

+ Expand

Extracting EV-miRNAs from Follicular Fluid

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Methods for RNA extraction from follicular fluid have been previously described elsewhere^{52 (link)}; however in short, samples were thawed and centrifuged for 15 min at 1200 × g at room temperature. They were subsequently centrifuged at 1000, 2000, and 3000 × g for 15 min at 4 °C. The samples were then ultra-centrifuged for the extraction of EV, as ultracentrifugation is considered the standard according to International Society for Extracellular Vesicle recommendations^{58 (link)}, (Beckman Coulter Optima-MAX-XP) at 110,000 × g for 75 min at 4 °C. The pellets obtained were kept at −80 °C until use. EV-miRNAs were extracted from the aforementioned follicular fluid pellets using the miRNAeasyKit and RNeasy CleanUp Kit as described (Qiagen, Valencia, CA, USA). The final purified miRNA-enriched RNA was eluted into 20 ul of RNAse-free water and stored at −80 °C until further use.

Martinez R.M., Liang L., Racowsky C., Dioni L., Mansur A., Adir M., Bollati V., Baccarelli A.A., Hauser R, & Machtinger R. (2018). Extracellular microRNAs profile in human follicular fluid and IVF outcomes. Scientific Reports, 8, 17036.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!