Real-time qPCR targeting an 82 bp region of the ompA gene was performed to detect C. burnetii DNA [70 (link)]. A total of 20 μL reaction mixture comprising of 10 μL of Sensifast SYBR No Rox master mix (Bioline), 0.4 μM of each primer (S1 Table ) (Integrated DNA Technologies), 5 μL of template DNA template, and Milli-Q filtered water to reach the final volume were prepared. The cycling parameters were; 3 mins at 95°C, followed by 45 cycles of 5 sec at 95°C and 20 sec at 65°C. Genomic DNA extracted from C. burnetii Nine Mile Phase Ⅱ was used as positive control template and Milli-Q filtered water was used as negative control template.
Sensifast sybr no rox master mix
Manufactured by Meridian Bioscience
Sourced in United States, United Kingdom
Sensifast SYBR No Rox master mix is a ready-to-use solution for real-time PCR amplification and detection using SYBR Green chemistry. It is designed for high-throughput and sensitive real-time PCR without the need for a passive reference dye.
Automatically generated - may contain errors
Lab products found in correlation
S1 table, by Integrated DNA Technologies (1 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Cfx connect instrument, by Bio-Rad (1 mentions)
Anti flag antibody clone m2, by Merck Group (1 mentions)
Protein g dynabead, by Thermo Fisher Scientific (1 mentions)
Minielute pcr purification kit, by Qiagen (1 mentions)
Icycler thermal cycler, by Bio-Rad (1 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (1 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
Gblocks gene fragment, by Integrated DNA Technologies (1 mentions)
Lightcycler 480, by Meridian Bioscience (1 mentions)
Pcr2.1 topo ta vector, by Thermo Fisher Scientific (1 mentions)
8 protocols using sensifast sybr no rox master mix
1
Detecting C. burnetii via Real-time qPCR
2
Quantifying Embryonic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total blastocyst RNA was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA synthesis was completed with a SensiFAST™ cDNA synthesis kit (Bioline Inc., Taunton, MA, U.S.A.). The mRNA levels were quantified on a
Mastercycler® ep realplex4 (Eppendorf AG, 22331 Hambrug, Germany). The reaction mixture contained SensiFAST™ SYBR No-ROX Master Mix (Bioline Inc., Taunton, MA, U.S.A.). The DNA sequences of the
oligonucleotides used for the qRT-PCR analysis are given inTable 1 Primers used for real-time PCR amplification of embryonic genes
method.
Mastercycler® ep realplex4 (Eppendorf AG, 22331 Hambrug, Germany). The reaction mixture contained SensiFAST™ SYBR No-ROX Master Mix (Bioline Inc., Taunton, MA, U.S.A.). The DNA sequences of the
oligonucleotides used for the qRT-PCR analysis are given in
| Genes | Primer sequence (5′→3′) | Accession no. |
|---|---|---|
| INFτ | F 5′ TGTTGGAGCCCAGTGCAGA 3′ | X65539 |
| R 5′ TCCATGAGATGCTCCAGCAGT 3′ | ||
| PLAC8 | F 5′ GACTGGCAGACTGGCATCTT 3′ | NM 1076987 |
| R 5′ CTCATGGCGACACTTGATCC 3′ | ||
| IGF-2r | F 5′ CAGGTCTTGCAACTGGTGTATGA 3′ | J03527 |
| R 5′ TTGTCCAGGGAGATCAGCATG 3′ | ||
| Hsp70 | F 5′ GACAAGTGCCAGGAGGTGATTT 3′ | U09861 |
| R 5′ CAGTCTGCTGATGATGGGGTTA 3′ | ||
| BAX | F 5′ TGACGAGATCATGAAGACAG 3′ | XM010823819 |
| R 5′ GCTCCATGTTACTGTCCAAT 3′ | ||
| BCL2 | F 5′ ATTTGCTGCTTATTCTGCTC 3′ | XM006058115 |
| R 5′ ATCCACTGTACTGCCATCTC 3′ | ||
| GAPDH | F 5′ GTCTGTTGTGGATCTGACCT 3′ | XM001252511 |
| R 5′ AGAAGAGTGAGTGTCGCTGT 3′ |
F: forward primer, R: reverse primer.
method.
3
Quantifying GFAP and Iba1 Changes in SCI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze changes in steady-state levels of GFAP and Iba1 transcripts between SCI and Sham rats we used the CFX96 Touch™Real-Time PCR Detection System (BioRad, Gladesville, NSW, Australia). The ribosomal protein 18S was used as the housekeeping gene. qPCR experiments were carried out by following a modified protocol, adapted from our previous study (Castorina et al., 2013). 3 μL of diluted cDNA (10 ng/μL), 5 μL of SensiFAST SYBR®No-ROX master mix (Bioline), 0.8 μL of 5 μM forward primer, 0.8 μL of 5 μM reverse primer and 0.4 μL of MilliQH2O were added to a final volume of 10 µL per reaction. Differentially expressed genes were analysed using the ΔΔCt method and are expressed as mean fold change (Schmittgen and Livak, 2008). The ΔΔCt of each sample was obtained by subtracting the calibrator (Sham) ΔCt to the target sample ΔCt and then applying the formula 2–ΔΔCt. Baseline measurements were set to 1. PCR product specificity was assessed by melting curve analysis, with each gene displaying an individual peak. The sequences of the genes used in this study are listed in Table 1
4
Chromatin Immunoprecipitation (ChIP) in Yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed following a previously described protocol (39 (link)). Briefly, chromatin fraction was isolated from yeast cells that were cross-linked with 1% formaldehyde and quenched with 136 mM glycine. Following the sonication step to shear the DNA to ∼750 bp (QSONICA sonicator with a microtip), samples were incubated with anti-FLAG antibody (clone M2 - Sigma) conjugated to Protein G Dynabeads (Life Technologies) overnight at 4°C. After washing, cross-link was reversed by incubation with proteinase K at 42°C for four hours and at 65°C for 12 h. DNA was isolated using MiniElute PCR Purification Kit (Qiagen). qPCR was performed using SensiFAST SYBR no-ROX Mastermix (Bioline) and CFX Connect instrument (Biorad). For each PCR reaction, 10 ng of input or ChIP DNA was used as template. The final concentration of the primer was 0.4 μM each. Cycling conditions were 95°C for 3 min followed by 40 cycles of 95°C for 5 s, 60°C for 10 s, and 72°C for 10 s. Ct values were determined using the CFX Manager software. Ct values for each ChIP samples were first normalized to the ChIP experiment carried out with yeast cells expressing untagged-Sub1 proteins and then divided by the values for the CAN1 locus to calculate the relative fold enrichment. Primers used in the qPCR analysis are listed in the Supplementary Table S1 .
5
Quantitative Real-Time PCR Analysis of Renal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, reverse transcription of 1 μg total renal RNA into cDNA was carried out using random hexamer primers and the High-Capacity cDNA Archive Kit (Applied Biosystem, USA) according to the manufacturer’s protocol in Bio Rad iCycler™ Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Second, in the real-time polymerase chain reaction (PCR) step, PCR products were amplified from the cDNA samples using SensiFAST™ SYBR® No-ROX Master Mix (Bioline) and target specific primer pairs to detect messenger RNA levels of adiponectin (Adpn), interleukine-1 beta (IL-1β), leptin receptor short-form (Ob-Ra), neutrophil gelatinase associated Lcn2 (NGAL), nuclear factor (erythroid-derived 2)-like 2 (NFE2L2 or Nrf2), PPAR-gamma (PPARγ), tumor necrosis factor alpha (TNFα), transforming growth factor β1 (TGF-β1) were used. Primers were self-designed by the NCBI/Primer-BLAST online software and synthesized by Integrated DNA Technologies (IDT, Inc., Coralville, IA, USA), for detailed list of Fwd and Rev primer sequences see Table 1 ). All measurements were done in duplicates. Target mRNA levels were normalized to Gapdh mRNA or to 28S rRNA levels.
6
qPCR Validation of Metatranscriptomic Differential Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was used as an independent validation of read count values used to generate contigs for differential expression analysis. Contigs representing termite, bacteria, protist, up-regulated, down-regulated, and no change groups were selected for qPCR validation (Additional file 1 : Table S2). Using the cDNA samples generated as described previously, 1 μL of cDNA, 1 μL each of contig-specific forward/reverse primers, 7 μL nuclease-free water, and 10 μL of SensiFast SYBR no ROX master mix (Bioline) were combined for qPCR using a Bio-Rad CFX-96 system. After an initial denaturation step (10 min. at 95 °C), 45 cycles of denaturing (30 s. at 95 °C), annealing (30 s. at 50 °C), and extension (30 s. at 72 °C) were performed with a real-time scan of fluorescence taken after each cycle. The log ratio CT values were regressed against log ratio of metatranscriptome counts per million values as a measure of congruency. Regression data were analyzed by the Spearman correlation method.
7
Quantifying Bacterial Abundance in Produced Water
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacterial abundance in produced water samples was measured using qPCR with 16S rRNA gene primers (F: GTGSTGCAYGGYTGTCGTCA; R: ACGTCRTCCMCACCTTCCTC) designed by Maeda et al. (2003) (link) with an expected amplicon size of 146 base pairs. qPCR reactions were run in triplicate on a Magnetic Induction Cycler (MIC) (Bio Molecular Systems, Upper Coomera, Australia). Each reaction contained 2X SensiFAST SYBR No-Rox master mix (Bioline, London, United Kingdom), 400 nM forward primer, 400 nM reverse primer, and 1 μL of template DNA for a total reaction of 20 μL. qPCR conditions consisted of a polymerase activation step at 95°C for 2 min followed by 40 amplification cycles each consisting of: denaturation at 95°C for 5 s, annealing at 62°C for 5 s, and an extension step at 72°C for 1 s. Standard curves were generated using gBlocks Gene Fragments (Integrated DNA Technologies, Coralville, IA, United States) (Supplementary Data 1 and Supplementary Figure 1 ) and negative control samples were included in each amplification assay.
8
qPCR Detection of p-crAssphage DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotide primer pairs were designed based on the p-crAssphage DNA polymerase sequence UGP_018 (Dutilh et al., 2014) using PerlPrimer software (Marshall, 2004) . Primer sequences are as follows: pCrAss-DNAPol-Fwd5 5'-GCCTATTGTTGCTCAAGC TATTGAA-3' and pCrAss-DNAPol-Rev5 5'-ACAACAGAACCAGCTGCCAT-3'. PCR products were cloned into pCR2.1-TOPO TA vector (Thermo Fisher Scientific) and obtained plasmids at known concentrations were used to establish calibration curves through serial ten-fold dilutions. This plasmid was denoted as pCR2.1::pCrAssDNApol5. Subsequently, qPCR were run in 15ml reaction volumes using SensiFAST SYBR No-ROX mastermix (Bioline) and LightCycler 480 thermocycler with the following conditions: initial denaturation at 95 C for 5 minutes, then 35 cycles of 94 C for 20 seconds, 55 C for 20 seconds and 72 C for 20 seconds, with a final extension at 72 C for 7 minutes. All samples were run in triplicate and the standard error was determined following calculation of DNA concentration based on the above standard curve.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!