Egfp paxillin

EGFP-paxillin (no. 15233; a gift from Dr. Rick Horwitz) and EGFP-RLC (no. 35680; a gift from Dr. Tom Egelhoff) were obtained from Addgene (Watertown, MA). 1–2 µg of plasmid was used to transfect 500,000 cells in each well of a 6-well plate using Lipofectamine 2000 (5–10 µL; Thermo Fisher) in OptiMEM (400 µL; Thermo Fisher). After 20 min at room temperature, plasmid in Lipofectamine 2000/OptiMEM was then incubated with cells in complete media (2 mL) overnight.

EGFP-paxillin (plasmid #15233), FLAG-paxillin (plasmid #15212), GFP-LC3 (plasmid #22405), mCherry-LC3 (plasmid #40827), GFP-Rab7 (plasmid #12605), GFP-Rab7-T22N (plasmid #12662) were obtained from Addgene. FLAG-paxillin-Y118F was further modified by GeneScript Inc. Primers used for mutation of the EGFP-paxillin and HA-Cbl (kindly provided by Dr. Youcef Yarden, Department of Biological Regulation, The Weizmann Institute of Science, Rehovot, Israel) using site-directed mutagenesis kit (Stratagene): EGFP-paxillin-Y31F: sense, 5′-CAGAGGAAACGCCTTT CTCCTACCAACTGG-3′; antisense, 5′-CCAGTT GGGTA GGAGAAAGGCGTTTCCTCTG-3′, EGFP-paxillin-Y118F: sense, 5′- GAGGAGGAA CACCTGTTCAGCTT CCCAAACAG-3′; antisense, 5′-CTTGTTTGGGAAGCT GAACACGTGTTCCTCCTC-3′ and HA-Cbl-C381A: sense, 5′-GATGGGCTCCACATTCCAACTAGCTAA AA TATGTGCTGAAAATGATA -3′; antisense, 5′-TATCA TTTTCAGCACATATTTTAGCTAGT TGGAATGTGG AGCCCATC-3′. All plasmids were transfected into BT-20 cells using Lipofectamine LTX and PLUS reagents (Invitrogen) according to the manufacturer′s instructions.