T7 rna polymerase

For each region, ~ 500 bp gene fragments for ORF1ab (NC_045512.2: 416–931 and 12,869–13,388) and N gene (NC_045512.2: 28,246–28,747) were synthesised with an additional 100 bp up and downstream of the target region (ThermoFisher) (Supplementary Table 2). Each fragment contained a T7 promoter for transcription and M13 adapters for amplification. Seven DNA standards from synthesised gene fragments were prepared for ORF1ab (100,000, 10,000, 5000, 1000, 500, 250 and 100 copies/µl) while eight DNA standards were prepared for the N gene (100,000, 10,000, 5000, 1000, 500, 250, 100 and 10 copies/µl).
For RNA, 1 pg of synthesised gene fragments were transcribed overnight at 37 °C using T7 RNA polymerase (Sigma). Overnight DNA digestion was performed using the turbo DNA free kit (ThermoFisher) and further treated with DNase I (NEB) until all traces of DNA were removed. Complete DNA removal was confirmed after each round of DNase treatment using rt-PCR with the SensiFAST SYBR kit (Bioline) and F1/R1 MCDA primers (Supplementary Table 1). The transcribed RNA was serially diluted and used as input. Since the amount of RNA transcribed was below the 250 pg/µl limit of detection for Qubit HS RNA assay (ThermoFisher), the input RNA copy number could not be determined. Therefore, the lowest detectable dilutions were used for sensitivity comparison.

Hydra polyps were treated with target inhibitors for 8 h and decapitated. After decapitation, the inhibitor treatment continued until the target time points of 1, 2, 4, and 8 hpa. The polyps were then relaxed by treatment with 2% urethane/HM for 2 min and fixed using 4% PFA/HM at 4°C overnight. Digoxigenin-labelled RNA probes for Hv_Bra1 were prepared by in vitro transcriptions from templates amplified from a recombinant pCR Blunt II TOPO (Cat # 450031; Invitrogen) plasmid containing the Hv_Bra1 gene using PCR. (DIG Labelling Mix, Cat # 1277073910; Sigma-Aldrich; SP6 RNA Polymerase, Cat # 10810274001; Sigma-Aldrich; T7 RNA Polymerase, Cat # 10881767001; Sigma-Aldrich). Whole-mount in situ hybridization was performed on the polyps as described previously (Martinez et al, 1997 (link)) with the following changes. Treatment with proteinase-K was performed for 5 min, and heat inactivation of the endogenous alkaline phosphatases was done at 70°C for 15 min in 1X SSC. Digoxigenin-labelled RNA probe at a concentration of 150 ng/ml was used for hybridization at 59°C. The post-hybridization washes were performed using 1X SSC-HS gradients. After staining with 50% NTMT/50% BM-purple AP substrate for 1 h at room temperature, the animals were mounted in 80% glycerol for imaging.

In this study, pre-miR-664a, pre-miR-664a-U1A, and pre-miRNA-U1A control (non-targeting pre-miRNA containing the U1A recognition sequence) were prepared by in vitro transcription. To generate DNA templates for transcription, primer extension was performed using 2 µM of each primer (shown in Table S1) in a reaction mixture containing KOD Dash DNA polymerase (TOYOBO, Osaka, Japan). The resulting template DNA was precipitated with 2-propanol. T7 RNA polymerase was prepared as described previously^{21 (link)}. The transcription reaction was carried out at 37 °C for 4 h in a reaction mixture containing 40 mM Tris–HCl (pH 8.0), 24 mM MgCl₂, 5 mM dithiothreitol, 10 mM guanosine monophosphate, 2 mM of each NTP, 1.8 U/mL inorganic pyrophosphatase (Sigma, St. Louis, MO, USA), 26.2 µg/mL purified T7 RNA polymerase, and 10 µg/mL DNA template. The pre-miRNA transcripts were purified using an 8% denaturing polyacrylamide gel. All pre-miRNAs were renatured by incubating for 1 min at 85 °C, followed by slow cooling to 4 °C.
The FAM-labeled RNA (RNA-FAM) was purchased from Hokkaido System Science (Hokkaido, Japan). The RNA-FAM sequence was as follows: 5′-GAU UAU GUC CGG UUA UGU ACA UUG CAC UCC GUA CAU AAC CGG ACA UAA UCdT dT-FAM-3′ (the U1A binding sequence is underlined).

In vitro T7 RNA Polymerase-transcribed 968 nucleotide (nt) DvSnf7 RNA (IVT DvSnf7 RNA) was used to treat soil samples and serve as the reference standard for the QuantiGene 2.0 microplate assay [24] (link). This 968-nt transcript is produced in transgenic maize containing a DvSnf7 suppression cassette and was determined by cDNA sequencing to include a 240-nt inverted repeat region and adjacent 5′- and 3′ sequences. The 968-nt DvSnf7 fragment was amplified by PCR from the original plant transformation vector and cloned downstream of a synthetic T7 promoter sequence (TAATACGACTCACTATAGGG) in pUC19 plasmid. The identity of the recombinant pUC plasmid template used to produce the IVT DvSnf7 RNA was verified by DNA sequencing. For IVT RNA synthesis, the pUC plasmid was linearized by BglII restriction digestion and incubated with nucleoside triphosphates (8 mM each, Sigma) and T7 RNA Polymerase in transcription buffer overnight at 37°C. The reaction was then treated with DNase I (100 units per 1 mL, Ambion) and extracted with phenol∶chloroform (1∶1 volume∶volume). The size of the IVT DvSnf7 RNA was confirmed by agarose gel electrophoresis and its concentration was determined using a NanoDrop 8000 (Thermo Scientific, Wilmington, DE) according to the manufacturer's instruction. Aliquots of the IVT DvSnf7 RNA sample were stored in a −80°C freezer.

Transcription templates were prepared by PCR amplification from a plasmid-borne gene for the TPP riboswitch using primers hybridizing to the T7 promoter and the 3′-end of the riboswitch. RNA was transcribed from 75 μg/ml DNA template in 30 mM Tris–HCl (pH 8.0), 10 mM DTT, 0.1% Triton X-100, 0.1 mM spermidine–HCl, 4 mM each NTP (Sigma; pH adjusted to 8.0), 40 mM MgCl₂, 50 μg/ml T7 RNA polymerase, 1 U/ml inorganic pyrophosphatase (Sigma), for 3 to 3.5 h at 37°C. The products were purified by gel electrophoresis under denaturing conditions. RNA was extracted from gel slices by electroelution and exchanged five times into 40 mM K-Hepes (pH 7.5), 100 mM KCl, 10 mM MgCl₂ for ITC analysis, or 25 mM Tris, 192 mM glycine (pH 8.3), 1 mM MgCl₂ for analysis by gel electrophoresis. Concentrations were measured by absorbance at 260 nm using extinction coefficients calculated from the nucleotide composition and a hypochromic effect correction factor.
The sequence (written 5′ to 3′) of the unmodified E. coli TPP riboswitch was:
GGACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUUC