Mutagenic primers

Manufactured by Merck Group

Sourced in United States

Mutagenic primers are a type of laboratory equipment used in molecular biology and genetics research. They are short DNA sequences designed to introduce specific mutations or changes in the genetic material of organisms during DNA amplification processes, such as polymerase chain reaction (PCR). Mutagenic primers serve as a tool for researchers to study the effects of genetic variations and their implications in biological systems.

Automatically generated - may contain errors

Lab products found in correlation

Q5 site directed mutagenesis kit, by New England Biolabs (2 mentions) Qiaprep spin miniprep kit, by Qiagen (1 mentions) T4 ligase, by Thermo Fisher Scientific (1 mentions) Ni sepharose 6 fast flow, by Cytiva (1 mentions) Hek293t cell, by American Type Culture Collection (1 mentions) Sanger method, by Genewiz (1 mentions) Xl1 blue, by Agilent Technologies (1 mentions) Pgex 6p 1, by GE Healthcare (1 mentions)

7 protocols using mutagenic primers

Site-Directed Mutagenesis of mTRF1 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

For site-directed mutagenesis, QuickChange lightning multi site-directed mutagenesis (210513, Agilent Technologies) was used. In brief, PCRs were performed following the manufacturer’s protocol with either the pDEST565-mTRF1 expression vector or the eGFP-TRF1 pWzl-Hygro retroviral vector as templates and the following PAGE purified mutagenic primers (Sigma-Aldrich):
mTRF1-T330A: 5′-GAACGAAGCAAGAACAGGAGCTCTTCAGTGTGAAACAAC-3′.
mTRF1-S344A: 5′-GGAAAGGAACCGAAGAACCGCTGGAAGGAATAGATTGTGT-3′.
mTRF1-T248A: 5′-CAACTTTTCTAATGAAGGCAGCAGCAAAAGTAGTGGAAAATGAGAAA-3′.
PCR products were digested with Dpn I restriction enzyme to digest the parental (non-mutated) DNA for 1 h at 37 °C and then, transformed into XL-10-Gold^® ultracompetent cells. Individual colonies were grown and DNA extracted with QIAprep Spin Miniprep Kit (27106, QIAGEN). Mutations were confirmed by sequencing with a specific TRF1 primer 5′-TTCCACTCCCTTTTCCAACACT-3′. Finally, 50 ng of each mutant DNA was used to transform BL21(DE3). Protein production and phosphorylation of the respective mutant GST-TRF1 protein were carried out following the same protocols described above.

Méndez-Pertuz M., Martínez P., Blanco-Aparicio C., Gómez-Casero E., Belen García A., Martínez-Torrecuadrada J., Palafox M., Cortés J., Serra V., Pastor J, & Blasco M.A. (2017). Modulation of telomere protection by the PI3K/AKT pathway. Nature Communications, 8, 1278.

+ Open protocol

+ Expand

Engineered IMP1 KH(3)4 mutants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The KH34 di-domain cDNA construct (P387–A573, Y396F) of G. gallus insulin like growth factor 2 mRNA binding protein 1 (IMP1 – Gene ID 395953) and GDDG mutants (KH(3)4 and KH3(4)) were inserted into pETM11 expression vector as previously described (18 (link),19 (link)). The V140I/P141S double mutant of KH(3)4 was generated using the Q5^® Site-Directed Mutagenesis Kit (NEB). Mutagenic primers (Sigma) were designed with the NEB changer webtool following kit specifications, and optimised using Primer3+ (20 ).
(V523I/P524S_F: GGTGGTGATTTCACGGGATCAGACCCCTGA; V523I/P524S_R: TCTGCAGCCGTCAGGTTCTGCAGCTCAT). Successful mutagenesis was confirmed by DNA sequencing (Source Bioscience).

Nicastro G., Abis G., Klein P., Esteban-Serna S., Gallagher C., Chaves-Arquero B., Cai Y., Figueiredo A.M., Martin S.R., Patani R., Taylor I.A, & Ramos A. (2023). Direct m6A recognition by IMP1 underlays an alternative model of target selection for non-canonical methyl-readers. Nucleic Acids Research, 51(16), 8774-8786.

+ Open protocol

+ Expand

Protein Expression and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ni-Sepharose 6 Fast Flow was from Cytiva. Mutagenic primers were also ordered from Sigma-Aldrich (Merck; St. Louis, MO, USA). T4 ligase was purchased from ThermoFisher and the restriction enzyme BsaI was purchased from New England Biolabs. The E. coli NEB 10-beta and BL21-AI (NEB, Ipswich, MA, USA) strains were used as hosts for cloning and protein expression, respectively. All other reagents and chemicals were purchased from Sigma-Aldrich.

Tong Y., Rozeboom H.J., Loonstra M.R., Wijma H.J, & Fraaije M.W. (2023). Characterization of two bacterial multi-flavinylated proteins harboring multiple covalent flavin cofactors. BBA Advances, 4, 100097.

+ Open protocol

+ Expand

Reagents and Materials for Biochemical Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

All of the plasmids for bacterial expression were obtained as gifts from individual laboratories or purchased from addgene (Table S1). Mutagenic primers were obtained from Sigma-Aldrich (Table S2). Commercially available competent bacterial cells were used for protein expression and mutagenesis. HEK293T cells were obtained from American Type Culture Collection and used following the manufacturer’s protocol. All of the antibodies used in this study were purchased from established vendors and used following the manufacturer’s protocol. AzF 1 was a kind gift from K. Islam (University of Pittsburgh) synthesized and characterized as reported previously (26 (link)). All histone and non-histone peptides 2 to 9 were synthesized by GL Biochem Ltd and S. Biochem Ltd and purified by HPLC to 98% purity (Figs. S2–S17 and Table S3). The concentrations of unlabeled peptides 2, 3, 8, and 9 were determined on the basis of the observation that 1 mg/ml peptide generates an absorbance (A₂₀₅) of 30 at 205 nm (40 (link)). The concentrations of TAMRA-labeled peptides 4 to 7 were determined by measuring the absorbance at a wavelength of 555 nm with an extinction coefficient of 65,000 L⁻¹ cm⁻¹ M⁻¹. The integrity of the purified peptides was confirmed by MALDI-MS.

Barman S., Padhan J, & Sudhamalla B. (2023). Uncovering the non-histone interactome of the BRPF1 bromodomain using site-specific azide-acetyllysine photochemistry. The Journal of Biological Chemistry, 300(1), 105551.

+ Open protocol

+ Expand

Retromer Electrostatic Mutant Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Retromer constructs were generated in the labs of David Owen and Brett Collins and have been published previously (Collins et al., 2005 (link), 2008 (link)). We used a two-stage quick-change mutagenesis protocol adapted from Wang and Malcolm (Biotechniques 1999) to introduce point mutations into retromer plasmids to generate retromer electrostatic mutants. Briefly, mutagenic primers (Sigma) were created for the desired mutations. In the first step, two polymerase chain reactions (PCRs), with either the mutagenic 5’ or 3’ primer, were amplified around the plasmid. The two reactions were then combined in an additional PCR step, and the product was digested using Dpn I. Digested product was used to transform XL1 Blue (Agilent) competent cells, and colonies were sequenced using Sanger methods (Genewiz).

Kendall A.K., Xie B., Xu P., Wang J., Burcham R., Frazier M.N., Binshtein E., Wei H., Graham T.R., Nakagawa T, & Jackson L.P. (2020). Mammalian Retromer Is an Adaptable Scaffold for Cargo Sorting from Endosomes. Structure (London, England : 1993), 28(4), 393-405.e4.

+ Open protocol

+ Expand

Mutagenesis of EPHX2 Protein Cysteine Residues

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The EPHX2 (T230-M555—hsEH CTD) cDNA was cloned in the bacterial expression vector pET3a, as described previously^{41 (link)}. Single mutants C423S and C522S were generated with the Q5^® Site-Directed Mutagenesis Kit (NEB). The double mutant C423S/C522S (C423S/C522S) was produced through two subsequent cycles of mutagenesis using the same kit. The mutagenic primers (Sigma), were designed with the NEB changer webtool according to the kit specifications (C423S_R: 5′GCATAAAGTCAGTGAAGCGGG3′; C423S_F: 5′ATGGATAAAACACTCTCATCG3′; C522S_R: 5′CATTGAGGACAGTGGGCACTG3′; C522S_F: 5′TGTCCCCTTTTCAGGTGG3′). Successful mutagenesis was confirmed by sequencing (Eurofins MWG).

Abis G., Charles R.L., Kopec J., Yue W.W., Atkinson R.A., Bui T.T., Lynham S., Popova S., Sun Y.B., Fraternali F., Eaton P, & Conte M.R. (2019). 15-deoxy-Δ12,14-Prostaglandin J2 inhibits human soluble epoxide hydrolase by a dual orthosteric and allosteric mechanism. Communications Biology, 2, 188.

+ Open protocol

+ Expand

Recombinant Protein Expression and Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For structural and biochemical analyses, C-terminal His-tagged β′-COP and Glo3 were placed into the Nde I/BamHI or Nde I/HinD III sites of in-house vector pMW172 (Owen and Evans, 1998 (link)) under the control of the T7 promoter. N-terminal His-tagged yeast Arf1 was placed into the pET-21a⁺ vector in the Nde I/BamHI sites. The Glo3 BoCCS and GRM regions and β′-COP (residues 300–604) were ligated into BamHI/NotI sites of pGEX-6P-1 (GE Healthcare), resulting in N-terminal GST-tagged proteins with a 3C-protease cleavage site. Other GST-tagged Glo3 and β′-COP constructs were subcloned into Nde I/HinD III or Nde I/BamHI sites of pMWGST, a modified form of pMW172 incorporating a C-terminal, thrombin cleavable GST tag. A two-stage quick-change mutagenesis protocol was used to introduce mutations in Glo3 and β′-COP. In this protocol, mutagenic primers (Sigma-Aldrich) were created for the desired mutations. In the first step, two polymerase chain reactions (PCRs), with either the mutagenic 5′ or 3′ primer, were amplified around the plasmid. The two reactions were then combined in an additional PCR step, followed by Dpn I digest and transformation. All constructs were verified by sequencing (GENEWIZ) prior to use. Oligonucleotides used in this study may be found in Table S5.

Xie B., Guillem C., Date S.S., Cohen C.I., Jung C., Kendall A.K., Best J.T., Graham T.R, & Jackson L.P. (2023). An interaction between β′-COP and the ArfGAP, Glo3, maintains post-Golgi cargo recycling. The Journal of Cell Biology, 222(4), e202008061.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!