TargetScan's bioinformatics prediction (version 7.2; www.targetscan.org/vert_72 ) was used to predict gene targets for miR-143-3p. Gene ontology enrichment analysis and alternative analyses were carried out using EnrichR (version: January 23rd). An adjusted P-value cut-off of below 0.05 was used to filter results. The fragment of the 3'-untranslated region (UTR) of TAK1 [wild-type (wt) or mutant (mut)] was amplified and cloned into the pGL-control vector (Promega). Site-directed mutagenesis of the TAK1 3'-UTR at the putative miR-143-3p binding site was performed using a QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, USA). MIN6 cells at a density of 1x105 per well were seeded into a 24-well plate until they reached ~60% confluence. In total, 2.5 µg wild-type (wt)-TAK1-UTR-pGL3 or mutant (mut)-TAK1-UTR-pGL3 plasmids was co-transfected with 100 nM miR-143-3p mimics or inhibitors using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.). Following 48 h transfection, the luciferase activity was measured using a Dual-luciferase reporter assay system (Promega Corporation). pRL-TK plasmid, containing the Renilla luciferase activity, was transfected as an internal control.
Pgl control vector
Manufactured by Promega
Sourced in United States
The PGL-control vector is a plasmid used in molecular biology experiments. It serves as a control for gene expression studies. The vector contains a promoter and a reporter gene that can be used to monitor transcriptional activity.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (8 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Pgl2 basic vector, by Promega (2 mentions)
Pgl basic vector, by Promega (2 mentions)
Dual luciferase reporter assay, by Promega (2 mentions)
Prl tk, by Promega (2 mentions)
Lipofectin reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Quickmutation kit, by Beyotime (1 mentions)
Usinglipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
10 protocols using pgl control vector
1
Validating miR-143-3p targeting of TAK1
2
Investigating miR-221 Regulation of RECK Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length RECK 3′-UTR was amplified from normal human cDNA and cloned into the NotI/XhoI sites downstream of the stop codon of Renilla luciferase in the pGL-control vector (Promega Corporation, Fitchburg, WI, USA). The corresponding mutant constructs were created by mutating the seed regions of the miR-221-binding sites. For the luciferase assay, approximately 5×103 K1 cells were added into a 6-well plate and incubated at 37°C until the cells were 60%–80% confluent. K1 cells were cotransfected with miR-221 mimic or miR-con and 200 ng plasmid pGL3-RECK WT or pGL3-RECK MUT using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol. Forty-eight hours after transfection, the cells were collected and luciferase activity was detected via the Dual-Luciferase Reporter Assay system (Promega Corporation). The specific activity is expressed as the fold change of the experimental group vs the miR-con group. The tests were repeated independently in triplicate.
3
Investigating miR-4262 Regulation of SIRT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TargetScan 7.2 (http://www.targetscan.org/vert_72/ ) was adopted to investigate the putative binding sites. The data suggested that SIRT1 was a potential target of miR-4262. Subsequently, the miR-4262 binding sites on SIRT1 3'-UTR, including wild-type or mutant, were inserted into the pGL-control vector (Promega Corporation) to construct a wild-type SIRT1 plasmid (SIRT1-WT) or SIRT1 mutation plasmid (SIRT1-MUT), respectively. The mimic control or miR-4262 mimic (Shanghai GenePharma Co., Ltd.) were then co-transfected with luciferase reporter vectors into Caco-2 cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h, according to the manufacturer's protocol. The luciferase activity was assessed using the Dual-Luciferase Reporter assay system (Promega Corporation) following the manufacturer's protocol. All luciferase activities were normalized to Renilla luciferase activity.
4
Luciferase Reporter Assay for Transcriptional Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic fragments of a 5′-transcriptional regulatory region of the 0.6 kb MK [12 (link)], the 0.5 kb Sur [13 (link)], or the 0.3 kb COX-2 [14 (link)] gene were cloned into pGL-2 basic vector (Promega, Madison, WI, USA) that contained the firefly luciferase gene. Plasmid DNA containing the respective genomic fragments, pGL-control vector (Promega) harboring the SV40 T antigen promoter-linked firefly luciferase gene, or pGL-basic vector without any transcriptional regulatory regions (Promega), and a control vector, the renilla luciferase gene fused with the herpes simplex virus-thymidine kinase gene promoter (pRL-TK, Promega), at a molar ratio of 10:1, was transfected into tumors with a lipofectin reagent (Life Technologies, Gaithersburg, MD, USA). Cell lysate on day 2 was assayed for the luciferase activity with the dual luciferase reporter assay (Promega). The firefly luciferase activity was standardized with the amounts of luminescence produced by renilla luciferase and the relative activity was expressed as a percentage of the SV40 T antigen promoter-mediated activity.
5
Validating miR-1184 Interaction with IL-16
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The putative binding site of miR-1184 at the 3'-UTR of IL-16 was predicted using miRanda (http://www.microrna.org/microrna/home.do ). To confirm whether there was a direct interaction between miR-1184 and IL-16, a luciferase reporter assay was performed. The wild-type (WT) 3'-UTR containing the binding site for miR-1184 was amplified by PCR, and the mutant-type (MUT) 3'-UTR was generated using a QuickMutation kit (Beyotime Institute of Biotechnology). The 3'-UTR sequences were inserted in the pGL-control vector (Promega, Corp.). The vectors constructed were separately transfected into monocytes together with either miR-1184 mimics or mimics NC using Lipofectamine 3000 (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. After 48 h of transfection, the activity of luciferase was evaluated using a Dual-Luciferase Reporter Assay System (Promega, Corp.) and normalized to Renilla luciferase activity.
6
Validating miR-219-5p Binding to TLR4 3'-UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The putative binding site of miR-219-5p at the 3’-UTR of TLR4 was predicted using
miRanda (http://www.microrna.org/microrna/home.do ). To confirm whether
there was a direct interaction between miR-219-5p and TLR4, a luciferase
reporter assay was performed. The wild-type (WT) 3’-UTR containing the binding
site of miR-219-5p or mutant-type (MT) 3’-UTR were inserted in the pGL-control
vector (Promega, Madison, WI, USA). The combined vectors were respectively
co-transfected into 239 cells with miR-219-5p mimic or mimic NC using
Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the
instruction of manufacturer. 48 h after transfection, the activity of firefly
luciferase was evaluated by a Dual-Luciferase Reporter Assay System
(Promega).
miRanda (
there was a direct interaction between miR-219-5p and TLR4, a luciferase
reporter assay was performed. The wild-type (WT) 3’-UTR containing the binding
site of miR-219-5p or mutant-type (MT) 3’-UTR were inserted in the pGL-control
vector (Promega, Madison, WI, USA). The combined vectors were respectively
co-transfected into 239 cells with miR-219-5p mimic or mimic NC using
Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the
instruction of manufacturer. 48 h after transfection, the activity of firefly
luciferase was evaluated by a Dual-Luciferase Reporter Assay System
(Promega).
7
miR-1323 Regulates TP53INP1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the TargetScan's bioinformatics prediction (version 7.2; www.targetscan.org/vert_72 ), complementary sequences of miR-1323 were searched at the 3'-UTR of TP53INP1. To confirm the interaction between miR-1323 and TP53INP1, a luciferase reporter assay was performed. The wild-type (WT) 3'-UTR containing the binding site of miR-1323 or mutant-type (MT) 3'-UTR were inserted into the pGL-control vector (Promega). According to the manufacturer's protocols, the combined vectors were co-transfected into HTR-8/SVneo and BeWo cells with miR-1323 mimic, miR-1323 inhibitor or the NCs using Lipofectamine 3000 reagent. After 48 h of transfection, relative luciferase activity was measured using a Dual-Luciferase Reporter assay system (Promega Corporation) and normalized to Renilla luciferase activity.
8
Predicting miR-137 Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bioinformatic analysis was conducted using TargetScan version 7.2 to predict miR-137 target genes. ACVR1 harbors putative miRNA-137 binding sites. Wild-type (WT: 5ʹGGUGAAUUUUUAAUCAGCAAUAU3’) or mutant type (MUT: 5ʹGGUGAAUUUUUAAUCUCGUUAUU3’) 3’-UTR sequences of ACVR1, which includes the miRNA-137 binding site or a mutated target site, was amplified and cloned into the pGL-control vector (Promega Corporation, WI, USA) to obtain the ACVR1-WT or ACVR1-MUT constructs using PmeI, XbaI and NotI restriction enzymes. To point-mutate the miR-137 binding domain on the 3ʹUTR of ACVR1, a QuikChange Site-Directed Mutagenesis Kit (Stratagene; Agilent Technologies, Inc.) was performed following the manufacturer’s instructions. The luciferase reporter vectors were verified by sequencing. Next, NP cells were co-transfected with the control-mimic or miR-137 mimic (Shanghai GenePharma Co., Ltd.) along with luciferase reporter vectors using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer’s protocol. After 48 h, the cells were collected, and luciferase activity was assessed using a Dual Luciferase Reporter Assay System (Promega Corporation) according to the manufacturer’s protocol [26 (link)].
9
Transcriptional Regulatory Regions Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic fragments containing a transcriptional regulatory region of the midkine (0.6 kb, GenBank: D10604)
[20 (link)], the survivin (0.5 kb, GenBank: U75285)
[21 (link)], or the cyclooxygenase-2 (0.3 kb, GenBank: U04636) gene
[22 (link)] were cloned into pGL-2 basic vector (Promega, Madison, WI, USA) that contained the firefly luciferase gene. Plasmid DNA containing the respective genomic fragments, pGL-control vector (Promega) harboring the SV40 T antigen promoter-linked firefly luciferase gene, pGL-2 basic vector containing the cytomegalovirus (CMV) promoter or pGL-basic vector without any transcriptional regulatory regions (Promega), and a control vector, the renilla luciferase gene fused with the herpes simplex virus-thymidine kinase gene promoter (pRL-TK, Promega), at a molar ratio of 10: 1, was transfected into MSCs with a lipofectin reagent (Life Technologies, Gaithersburg). Cell lysate on day 2 was assayed for the luciferase activity with the dual luciferase reporter assay (Promega). The firefly luciferase activity was standardized by the amounts of luminescence produced by renilla luciferase and the relative activity was expressed as a percentage of the SV40 T antigen promoter-mediated activity.
[20 (link)], the survivin (0.5 kb, GenBank: U75285)
[21 (link)], or the cyclooxygenase-2 (0.3 kb, GenBank: U04636) gene
[22 (link)] were cloned into pGL-2 basic vector (Promega, Madison, WI, USA) that contained the firefly luciferase gene. Plasmid DNA containing the respective genomic fragments, pGL-control vector (Promega) harboring the SV40 T antigen promoter-linked firefly luciferase gene, pGL-2 basic vector containing the cytomegalovirus (CMV) promoter or pGL-basic vector without any transcriptional regulatory regions (Promega), and a control vector, the renilla luciferase gene fused with the herpes simplex virus-thymidine kinase gene promoter (pRL-TK, Promega), at a molar ratio of 10: 1, was transfected into MSCs with a lipofectin reagent (Life Technologies, Gaithersburg). Cell lysate on day 2 was assayed for the luciferase activity with the dual luciferase reporter assay (Promega). The firefly luciferase activity was standardized by the amounts of luminescence produced by renilla luciferase and the relative activity was expressed as a percentage of the SV40 T antigen promoter-mediated activity.
10
Validating miR-200b-3p Binding to HMGB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This study used starBase V3.0 (https://starbase.sysu.edu.cn) to predict that the 3'-UTR of HMGB1 includes complementary sequence of miR-200b-3p. The luciferase reporter assay was performed to verify whether there has a direct interaction between miR-200b-3p and HMGB1. High-mobility group box 1-mutant-type (MUT) 3'-UTR and HMGB1-wild-type (WT) 3'-UTR containing the binding site of miR-200b-3p were, respectively, inserted in the pGL-control vector (Promega, Madison, WI, USA). The combined vectors were then co-transfected with miR-200b-3p mimic and mimic NC into 293 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). After 48 h of transfection, relative luciferase activity was measured using a dual-luciferase reporter assay system (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!