Total RNAs were isolated using TRIzol and then subjected to a two-step purification to obtain tRNA. First, a PureLink RNA Mini extraction kit (Life Technologies) was used to precipitate the ribosomal RNA in the sample. In the second step, size-exclusion chromatography (SEC-HPLC) was performed using an Agilent Bio SEC-3 column with 10 mM ammonium acetate at pH 7 as the mobile phase. Neutral pH was selected to minimize hydrolysis of ct6A. tRNA and rRNA were collected as separate fractions, vacuum concentrated and reconstituted in water. tRNA concentrations were determined by UV spectroscopy at 260 nm. In the yeast samples, the proportion of tRNA to ribosomal RNA was much higher so only SEC-HPLC fractionation was required to obtain pure tRNA for analysis.
Purelink rna mini extraction kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Australia
The PureLink RNA Mini Kit is a silica-based system for the purification of high-quality total RNA from a variety of sample types, including cultured cells, tissue, and blood. The kit utilizes a simple bind-wash-elute procedure to isolate RNA without the use of phenol or chloroform.
Automatically generated - may contain errors
Lab products found in correlation
Ssoadvanced universal sybr green supermix, by Bio-Rad (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Sec 3 column, by Agilent Technologies (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Purelink genomic dna extraction mini kit, by Thermo Fisher Scientific (1 mentions)
Qubit rna br assay kit, by Thermo Fisher Scientific (1 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time system c1000 touch thermal cycler, by Bio-Rad (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
2100 bioanalyzer instrument, by Agilent Technologies (1 mentions)
Rnalater stabilization solution, by Thermo Fisher Scientific (1 mentions)
Abi prism 7900, by Thermo Fisher Scientific (1 mentions)
First strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Cfx96 touch thermocycler, by Bio-Rad (1 mentions)
12 protocols using purelink rna mini extraction kit
1
Purification of tRNA from Total RNA
2
Profiling Gene Expression in Differentiated Memory B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from differentiated memory B cells at day 13 using the PureLink RNA Mini Extraction Kit (Life Technologies) according to the manufacturer’s protocol. Total RNA was then converted to cDNA using the high-capacity RNA-to-cDNA Kit (Applied Biosystems). Relative gene expression was measured using the TaqMan gene expression assay (BLIMP-1: Hs00153357_m1; XBP1: Hs00231936_m1; IRF4:Hs01056533_m1; PAX5: Hs00277134_m1; and BCL6: Hs00153368_m1). The expression averages of ACTB (Hs01060665_g1) and GAPDH (Hs02758991_g1) were used as endogenous controls, while day 0 naive B cells of the same individuals were used as undifferentiated controls. A final reaction mixture of 20 μL volume was prepared: 1 μL TaqMan probes, 5 μL TaqMan Gene Expression Master Mix (Applied Biosystems), and 30 ng cDNA in nuclease-free water. Relative fluorescence intensity was measured using the 7900HT Fast Real-Time PCR System (Applied Biosystems). Relative gene expression was calculated by correcting to the endogenous and undifferentiated controls: ΔΔCT = (CT [target, untreated] – CT [reference, untreated]) – (CT [target, treated] – CT [reference, treated]); ratio = 2ΔΔCT.
3
DNA and RNA Extraction from 3D Cell Culture
4
Real-Time qPCR Analysis of Ovarian Nr5a2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from postnatal day 4 (PND4) ovaries with PureLink RNA Mini-Extraction kit according to the manufacturer's instructions (Invitrogen, Waltham, MA). Reverse transcription was achieved using the SuperScript III reverse transcriptase (Invitrogen). Real-time quantitative polymerase chain reaction (qPCR) was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) with the CFX 96 Real-Time System, C1000 Touch Thermal Cycler (Bio-Rad Laboratories). The transcripts were amplified following the same cycling program: 30 s at 95 °C and then 40 cycles of 15 s at 95 °C and 30 s at 60 °C, followed by 5-s step of a 0.5 °C increase between 65 and 95 °C. Primers employed can be found in Supplementary Table S5 . For Nr5a2, primers were designed within the floxed portion of the sequence for the Nr5a2 transcript, with the forward primer in exon 3 and the reverse primer in exon 5.
5
RNA Isolation and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On day 6, all animals were euthanized by 5% Isoflurane overdose and cervical dislocation. Animals were weighed and all wound areas (2 per mouse) were excised, placed in 1 mL RNAlater™ Stabilization Solution (Thermo Fisher, Waltham, WA, USA), and stored at −80 °C until RNA isolation. Dermal punches were sent to University of Arizona Genetics Core (Tucson, AZ, USA) for RNA isolation. Total RNA was isolated from each mouse skin tissue sample using the Invitrogen PureLink RNA Mini extraction kit (Invitrogen, Carlsbad, CA, USA). RNA quantity and ribosomal RNA integrity (RIN) was determined using the 2100 Bioanalyzer Instrument (Agilent Technologies, Santa Clara, CA, USA). Primers for Gapdh, Sdha, As3mt, Mmp1a, Timp1, Esr1, Esr2, and Gper1 were designed using the total gene sequences (Primer3, NCBI) for each target gene assessed (Integrated Data Technologies, Coralville, IA, USA) (Table 1 ). A standard curve was run for each primer set and melting peaks were assessed. Reagents for cDNA synthesis/qPCR and thermocycler settings were previously described.
6
TRIM16 Transfection and Cancer Pathway Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from TRIM16 transfected G361 cell lines using the PureLink RNA mini extraction kit (Ambion, VIC, Australia), in accordance with the manufacturer's instruction. Cancer PathwayFinder PCR array was performed according to the manufacturer's instruction (SABiosciences, PAHS-033A) using an ABI Prism 7900 sequence detection system (Applied Biosystems, VIC, Australia).
7
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the PureLink RNA mini extraction kit (Ambion, Victoria, Australia), in accordance with the manufacturer’s instruction. Complementary DNA (cDNA) was synthesized using a first-strand cDNA synthesis kit (TaKaRa, Dalian, P.R. China). RT-PCR was performed with SYBR Premix Ex Taq™ (TaKaRa, Biotech Co., Ltd., Dalian, P.R. China). The following primer pairs were used for PCR amplification: TRIM16, 5′-GTGCATTGGGCTCCTTCCTCCTTA-3′ (forward) and 5′-CTGGCTGACCCAGGCTGGTCTT-3′ (reverse); GADPH, 5′-ATCCCATCACCATCTTCCAG-3′ (forward) and 5′-CCATCACGCCACAGTTTCC-3′ (reverse). Relative expression was standardized using the quantity of β-actin, and data were analyzed accordingto the 2−ΔΔCt formula.
8
Ovine Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell cultures was extracted using PureLink RNA mini extraction kit according to the manufacturer's instructions (12183025, Ambion by Life Technologies). Reverse transcription was performed on 1 µg RNA with SuperScript Vilo cDNA synthesis kit (Thermo Fisher Scientific). Real-time PCR was performed with 10μl SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Mississauga ON), 6μl of cDNA, 10 pmol primers (1.5 μl) and 1μl water in a CFX96 Touch thermocycler (Bio-Rad). Primers were designed to measure mRNA encoding ovine F8, luteinizing hormone receptor (LHCGR), FGF18, endothelin-1 (EDN1), SMAD4 and SMAD6 (Table 1). Common thermal cycling parameters (3 min at 95°C, 40 cycles of 15 s at 95°C, 30 s at 60°C and 30 s at 72°C) were used to amplify each transcript. Melting curve analyses were performed to verify production of single amplicons, and amplification efficiency of primer pairs was between 2.0 and 2.15 measured as described (Monniaux et al., 2008) . Samples were run in duplicate, and were expressed relative to the geometric mean of RPL19, SDHA and YWHAZ as housekeeping genes and expressed as the ratio R = [ERef Ct (Ref) /Etarget Ct (target) ] ( Estienne et al., 2015) .
9
PDLSCs Transcriptional Profile Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from the isolated PDLSCs was extracted using the PureLink RNA extraction mini kit, Invitrogen, USA (Catalogue number - 12183018A) following the manufacturer’s instructions. The extracted RNA was used for synthesis of cDNAs. Then the RT PCR was conducted with an obtained 1ng of RNA. The primers used in the experiment are listed in the Table 1 . The cDNAs were expanded using about 30–35 PCR cycles. Every cycle had denaturation for about 30 s, temperature being set at 94 °C and annealing and extension at 72 °C for about 30s. The PCR products were read by gel-electrophoresis.
Primers employed in the reverse-transcription PCR experiment.
| Gene | Primers |
|---|---|
| OCT-4A | Forward: 5′-TGGGCCAGGCTCTGAGGTGT -3′ |
| SOX-2 | Forward: 5′- GAGAACCCCAAGATGCACAAC -3′ |
| GADPH | Forward: 5′- GTCTCCTCTGACTTCAACAGCG -3′ |
| NANOG | Forward: 5′- GCCTCACACGGAGACTGTCTC -3′ |
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A commercial PureLink RNA extraction mini kit (Invitrogen, Thermo Fisher Scientific, Bleiswijk, The Netherlands) was used to extract total RNA from the cells. After RNA extraction, RNA samples were treated with DNAse I (Thermo Fisher Scientific, Vilnius, Lithuania) as per the manufacturer’s instructions and reverse transcribed with a High-Capacity Reverse Transcription kit (Life Technologies, Thermo Fisher Scientific, Bleiswijk, The Netherlands). Real-time PCR was performed using Power SYBR Green PCR mix under standard conditions on a 7900HT PCR system (Applied Biosystems, Foster City, CA, USA). PCR primers used are listed in Table A1 . For gene expression data normalisation, β-actin and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes were used as endogenous controls. Alterations in gene expression were analysed using the 2−∆∆ct method [32 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!