Nucleotrap mrna kit

Poly(A)+ RNA was isolated with Nucleo-Trap mRNA kit (Macherey-Nagel, Düren, Germany) and double strand cDNA synthesis was carried out using the double-stranded cDNA using SuperScript double-Stranded cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) according to manufacturer's instructions. Each double-stranded cDNA (120 ng) was sheared to ~400 bp fragments using an S220 ultrasonicator (Covaris, Woburn, MA, USA) with the following parameter settings: peak incident power, 140 W; duty factor, 10%; cycles per burst, 200; and treatment time, 55 seconds. The resulting DNA fragments were purified using 0.7× volume Agencourt AMPureXP beads (Beckman Coulter, Brea, CA, USA). Illumina libraries were prepared using the KAPA Library Preparation Kit (Kapa Biosystems, Wilmington, MA, USA) and TruSeq adaptors (Illumina, San Diego, CA, USA). Paired-end sequencing (151 bp × 2) of each sample was performed on a HiSeq2500 (Illumina, San Diego, CA, USA).

The total RNA of a tomato plant was extracted using TRIzol Reagent (Invitrogen, Guangzhou). The mRNA was purified using the NucleoTrap mRNA kit (Macherey-Nagel, Düren, Germany). Then, the cDNA samples were constructed using the Standard cDNA Synthesis Kit (Takara, Japan) according to Marioni et al. (56 (link)). All cDNA were sent to Beijing Genomics Institute (Shenzhen, China) for sequencing with the BGISEQ-500RS platform. SOAPnuke1.5.6 was used for reads trimming to remove adaptors and low-quality bases. HISAT (version 2.0.4) and Bowtie2 (version 2.2.5) were used to index reference genome and reads mapping. Tomato genome annotation ITAG3.2 was used as the reference genome. RSEM (version 1.2.8) was used to generate the count matrix. Reads count was normalized with FPKM, and NOISeq was used to identify differentially expressed genes (57 (link)). We selected the genes with a log₂ fold change ≥1.5 and deviation probability value ≥0.8 of each plant sample for further analyses. Gene set enrichment analysis was performed with AgriGO (version 2.0) (58 (link)). All three Gene Ontology (GO) (i.e., Molecular Function, Biological Process, and Cellular Component) and KEGG Plant pathways (59 (link)) were used. An adjusted P value < 0.05 cutoff was used for selecting significantly enriched GO terms and KEGG pathways.

RNA extraction and cDNA synthesis. Total RNA was extracted from cassava tissues through the sodium dodecyl sulfate method [44 (link)], and purified by NucleoTrap® mRNA kit (Macherey Nagel, Genmany) according to the manufacturer’s instruction. First strand cDNAs were synthesized by SMARTScribe™ Reverse Transcriptase from 200 ng of total RNA using primers of CDS III and Oligo III according to product manual.
The expression levels of MePFKs from different cassava tissues and from roots at different developmental stages were investigated by qRT-PCR analysis. qRT-PCR was performed in the thermal cycler of a Rotor-Gene 6000 (Rcorbett, Australia) using a SYBR Premix Ex TaqTM fluorescence quantitative kit (TaKaRa, Japan). Tubulin-F: 5′GTGGAGGAACTGGTTCTGGA3′ and Tubulin-R: 5′TGCACTCATCTGCATTCTCC3′ were used as reference gene [45 ]. The gene-specific primers are shown in Table S1. The PCR programme proceeded as follows: 95 °C for 30 s, 40 cycles of 95 °C for 10 s, 59 °C for 20 s and 72 °C for 30 s. Each sample had three technical replicates. The relative expression level was determined by the 2^{−Δ Δ Ct} method [46 (link)].