Iscripts cdna synthesis kit

Manufactured by Quanta Biosciences

Sourced in United States

The IScripts cDNA Synthesis kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains the necessary reagents and enzymes to efficiently convert RNA samples into stable cDNA for subsequent analysis or applications.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green real time pcr kit, by Quanta Biosciences (6 mentions) Trizol, by Thermo Fisher Scientific (5 mentions) Primescript rt master mix kit, by Takara Bio (2 mentions) Real time pcr system, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Qscript microrna cdna synthesis kit, by Quanta Biosciences (1 mentions)

Close spelling variants of this product

IScript cDNA synthesis kit IScriptTM Synthesis Kit CDNA synthesis kit

6 protocols using iscripts cdna synthesis kit

Chondrocyte Isolation and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary articular chondrocytes were isolated from articular cartilage of 4-day-old neonatal mice, as described previously^{52 (link)}. The isolated cells were treated with 4-OH tamoxifen (1 μM) for 24 hours. Total mRNA was extract with Trizol (Invitrogen Life Technologies, CA, USA). 1 μg total RNA was used to synthesize complementary DNA (cDNA) using an iScripts cDNA Synthesis kit (Quanta Biosciences, MD, USA). Real-time PCR amplification was performed using specific primers of genes encoding for matrix degradation enzymes and a SYBR Green real-time PCR kit (Quanta Biosciences, MD, USA). The primer names and sequences were listed in Table 1. Data were collected from cells of 3 independent mice (n = 3).Table 1

The names of sequences of primers used in this project.

Genes	Primer sequence (forward primers)	Primer sequence (reverse primers)
Runx2	GACTGTGGTTACCGTCATGGC	ACTTGGTTTTTCATAACAGCGGA
Mmp9	GCAGAGGCATACTTGTACCG	TGATGTTATGATGGTCCCACTTG
Mmp13	CTTCTTCTTGTTGAGCTGGACTC	CTGTGGAGGTCACTGTAGACT
Adamts4	ATGGCCTCAATCCATCCCAG	GCAAGCAGGGTTGGAATCTTTG
Adamts5	GGAGCGAGGCCATTTACAAC	CGTAGACAAGGTAGCCCACTTT
Adamts7	GCAGGCTTCGTCTGCTTTCTA	GCCATCAGATAAGGGTTGGTGG
Adamts12	GACCCGAGGCAAGAACATTTT	CCCAGTTGACCGTCAGATTGA
Col10a1	TTCTGCTGCTAATGTTCTTGACC	GGGATGAAGTATTGTGTCTTGGG
Actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

Liao L., Zhang S., Gu J., Takarada T., Yoneda Y., Huang J., Zhao L., Oh C.D., Li J., Wang B., Wang M, & Chen D. (2017). Deletion of Runx2 in Articular Chondrocytes Decelerates the Progression of DMM-Induced Osteoarthritis in Adult Mice. Scientific Reports, 7, 2371.

+ Open protocol

+ Expand

Axin1 Knockout Cartilage RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from primary TMJ cartilage tissues of Axin1^Agc1CreER mice and Cre-negative littermates at the ages of 6 months with TRIzol reagent (Invitrogen, Carlsbad, CA). One-microgram RNA was used to reversely transcribe into complementary DNA (cDNA) using an iScripts cDNA Synthesis kit (Quanta Biosciences, MD, USA). Real-time polymerase chain reaction (PCR) amplification was carried out with specific primers by SYBR Green real-time PCR kit (Quanta Biosciences). The primer sequences are listed in Table 1.

Zhou Y., Shu B., Xie R., Huang J., Zheng L., Zhou X., Xiao G., Zhao L, & Chen D. (2018). Deletion of Axin1 in condylar chondrocytes leads to osteoarthritis‐like phenotype in temporomandibular joint via activation of β‐catenin and FGF signaling. Journal of cellular physiology, 234(2), 1720-1729.

+ Open protocol

+ Expand

Quantifying Cytokine Expression in Disc Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleus pulposus tissues harvested from 55 subjects (34 cases and 21 controls) were lysed in TRIzol (Invitrogen Inc, Carlsbad, CA, USA) and total RNA was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The reverse transcriptions (RT) were performed using PrimeScript RT Master Mix kit (Takara, Japan), with 1 μg total RNA used for the synthesis of the complementary DNA (cDNA) via using iScripts cDNA Synthesis kit (Quanta Biosciences, MD, USA). SYBR Green real-time PCR kit (Quanta Biosciences, MD, USA) was used to measure the relative mRNA levels, and samples normalized for GAPDH expression. All reactions were run on a real-time PCR system (Applied Biosystems) and analyzed using the comparative Ct (ΔΔCt) method (2^-ΔΔCt with logarithm transformation). For profiling gene expressions, qRT-PCR was performed, using the primer pairs for IL-1α (5’-CCTCACCTTCCAGGAGAATGTG- 3’ and 5’-GCATCGCCCAGATTTTGTAG TG-3’), IL-1β (5’-CTGTCCTGCGTGTT GAAAGAT-3’ and 5’-TTCTGCTTGAGAG GTGCTGAT-3’), IL-1RN (5’-TTGTCCT GCTTTCTGTTCTCG-3’ and 5’-CTGTCC TGTGTCAAGTCTGG-3’), and GAPDH (5’-GACATGCCGCCTGGAGAAAC-3’ and 5’-AGCCCAGGATGCCCTTTAGT-3’).

Yang K., Xiao Q., Zhang R., Meng D., Wang J., Wei Q, & Jiang H. (2022). Gene locus polymorphisms and expression levels of interleukin-1 in lumbar disc disease: A MOOSE-compliant meta-analysis and immunohistochemical study. Medicine, 101(43), e31152.

+ Open protocol

+ Expand

Quantitative Expression Analysis of miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol (Invitrogen Life Technologies, CA, USA) was used for total RNA extraction. The RNA templates were then synthesized into cDNA using an iScripts cDNA Synthesis kit (Quanta BioSciences, MD, USA), and GAPDH was used as the control for normalization. The isolated miRNA was then quantified using a qScript microRNA cDNA synthesis kit (Quanta BioSciences, MD, USA), with U6 snRNA used as the internal control. Then a SYBR Green real-time PCR kit (Quanta Biosciences) was used to perform qRT-PCR, with a comparative threshold cycle (ΔΔCt) adopted for the calculation of gene expression. The primer sequences are shown in Supplementary Table 1.

Jiang H., Moro A., Wang J., Meng D., Zhan X, & Wei Q. (2021). MicroRNA-338-3p as a novel therapeutic target for intervertebral disc degeneration. Experimental & Molecular Medicine, 53(9), 1356-1365.

+ Open protocol

+ Expand

Quantifying Runx2-Dependent Cartilage Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

9-week-old Runx2^Agc1CreER mice and their Cre-negative control mice were sacrificed. TMJ condylar cartilage was collected from freshly sacrificed mice to obtain total RNA. Total mRNA was extract with Trizol (Invitrogen Life Technologies, CA). 1 μg total RNA was used to synthesize complementary DNA (cDNA) using an iScripts cDNA Synthesis kit (Quanta Biosciences, MD). Real-time PCR amplification was performed using specific primers of genes encoding for cartilage matrix proteins or matrix degradation enzymes and a SYBR Green real-time PCR kit (Quanta Biosciences, MD). The primer names and sequences were listed in Table 1. Data were collected from cartilage of 3 independent mice (n = 3).

Liao L., Zhang S., Zhou G.Q., Ye L., Huang J., Zhao L, & chen D. (2018). Deletion of Runx2 in Condylar Chondrocytes Disrupts TMJ Tissue Homeostasis. Journal of cellular physiology, 234(4), 3436-3444.

+ Open protocol

+ Expand

Quantifying Gene Expression in Intervertebral Discs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The intervertebral disc tissues were lysed in TRIzol (Invitrogen Inc, Carlsbad, CA, USA) and Rneasy Mini Kit (Qiagen, Valencia, CA, USA) used for total RNA extraction in accordance with manufacturer’s protocol. The reverse transcriptions (RT) were performed using PrimeScript RT Master Mix kit (Takara, Japan), with 1 μg total RNA used for the synthesis of the complementary DNA (cDNA) via using iScripts cDNA Synthesis kit (Quanta Biosciences, MD, USA). SYBR Green real-time PCR kit (Quanta Biosciences, MD, USA) was used to measure the relative mRNA levels, and samples normalized for GAPDH expression. All reactions were run on a real-time PCR system (Applied Biosystems) and analyzed using the comparative Ct (ΔΔCt) method (2^−ΔΔCt with logarithm transformation). The PCR primers used are as follows: GSDMC: Forward primer 5′-TGGAAGCAAAGACCTGACAC-3′; Reverse primer 5′-CCAAAATGATGAAGAGAATCC-3′ and GAPDH: Forward primer 5′-GACAT-GCCGCCTGGAGAAAC-3′; Reverse primer 5′-AGCCCAGGATGCCCTTTAGT-3′.

Jiang H., Moro A., Liu Y., Wang J., Meng D., Zhan X, & Wei Q. (2020). Two GWAS-identified variants are associated with lumbar spinal stenosis and Gasdermin-C expression in Chinese population. Scientific Reports, 10, 21069.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!