Iscript protocol

NK precursors (stage 1 and stage 2) were sorted according to their expression profiles described in supplementary figure 4a. Total RNA was extracted using RNeasy Micro Kit (Qiagen). The quality of the RNA obtained was evaluated using the Laboratory-Chip technique (Agilent Bioanalyzer) and subsequently preamplified according to the Ambion WTA expression protocol (Thermo Fischer). RNA was reverse transcribed into cDNA using the iScript protocol (Bio-Rad). QT-PCR was performed using the SsoAdvanced™ Universal SYBR® Green Supermix (BIO-RAD) and the MyCycler Thermal cycler system (Bio-Rad).Used primers: mNKG2D-S FW: AGTTGAGTTGAAGGCTTTGACTC, mNKG2D-S REV: ACTTTGCTGGCTTGAGGTC, DAP12 FW: GACTGTGGGAGGATTAAGTCC, DAP12 REV: AACACCAAGTCACCCAGAAC.

Mouse pineal gland and neural retina RNA (0.1 µg) was subjected to one-step RT-PCR using the iScript protocol (Bio-Rad, Hercules, CA), with the addition of random hexamer primer (2.5 µM). Primer sets used included those for mouse 18s rRNA, Basigin variant-1, and Basigin variant-2 (Ochrietor et al., 2003 (link)). Runs were performed in triplicate on a MiniOpticon Real-Time PCR system using the default cycling program of 50°C for 10 minutes, 95°C for 5 minutes, followed by 49 cycles of 95°C for 10 seconds, 55°C for 30 seconds, then 95°C for 1 minute, 55°C for 1 minute. A melt curve analysis was performed. All runs were performed in triplicate and the values obtained for the Basigin gene products were normalized to those of 18s rRNA within each tissue.