Gotaq g2 hot start dna polymerase

Reverse transcription was performed with 1000 ng RNA, using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany), according to the manufacturer’s protocol, with anchored oligo(dT)18 primer. Two technical replicates were prepared for each sample and subsequently tested for the presence of genomic DNA (gDNA) contamination. For this purpose, conventional PCR (GoTaq^® G2 Hot Start DNA polymerase; Promega, Madison, WI, USA) was carried out, with a primer pair designed against two different exons of an ATP synthase (ATPsyn; LOC109361517) gene sequence (primer sequences: F: AGTATGCTGTTCCTGTTCGTCA; R: ATGGTGATCTTCTCCTTCTTTAG). Two non-contaminated technical replicates of cDNA were mixed and 10-fold or 2-fold samples dilutions were used as template for the evaluation of gene expression. A mixture of non-diluted cDNA (5 µL of each sample) was prepared and used as a template for optimizing qPCR thermal conditions/efficiency, performed separately for the field and greenhouse experiment samples.

Genomic DNA from tail tips was extracted according to the standard phenol extraction/purification procedure. Genotyping was carried out using the following PCR primers: Fbxw7-RC-F (5′-CAACCAGTGCTCTAAATCACT-3′) and Fbxw7-RC-R (5′-CTCCACCTGTATGTCCCACTA-3′) for Fbxw7 alleles (Fig. 1B) and Cre-F (5′-GCATTACCGGTCGATGCAACGAGTGATGAG-3′) and Cre-R (5′-GAGTGAACGAACCTGGTCGAAATCAGTGCG-3′) for the Cre transgene. The wild-type allele was identified as a 338 bp PCR product, and the Fbxw7^LSL-R468C/+ knockin allele was identified as a 275 bp product. After Cre-mediated recombination, the Fbxw7^R468C knockin allele was identified as a 384 bp PCR product. The Cre transgene was detected as a PCR product of 408 bp. All PCRs were performed using GoTaq G2 Hot Start DNA polymerase (Promega) with 33 cycles at 98 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 1 min.