Total RNA was isolated from Sorghum plants cultivar B-35 (genotype BTx642) using the RNeasy plant mini kit (Qiagen, Germany). cDNA was prepared using RevertAid First strand cDNA synthesizing kit [Thermo Scientific, (EU) Lithuania] according to the manufacturer’s instruction, using oligo dT primer. The full-length open reading frame (ORF) of SbDhn1 was PCR-amplified using gene-specific primers (Supplementary Table S1 ) designed according to S. bicolor full-length cDNA sequence. The amplified PCR product was cloned into pGEMT-Easy vector (Promega, United States) and subsequently sequenced. The sequence obtained was virtually translated and used for BLAST analysis (Altschul et al., 1990 (link)) with the available report in the database (Accession no. AGS16688.1). All of the physicochemical parameters were calculated using ExPASy ProtParam tools. The virtually translated sequence of SbDHN1 was used to compare the protein with other dehydrin sequences from different plant species belonging to the family Poaceae. The alignment was performed using Clustal Omega1 program. A phylogeny was generated using dehydrin sequences from different members of Poaceae, belonging to different dehydrin types, using the Neighbor-Joining method in MEGA6 (Tamura et al., 2013 (link)). A bootstrap value was obtained from 1000 replicates.
Revertaid first strand cdna synthesizing kit
Manufactured by Thermo Fisher Scientific
The RevertAid First Strand cDNA Synthesis Kit is a reagent system designed for the synthesis of first-strand cDNA from total RNA or poly(A)+ RNA templates. It includes a thermostable RevertAid Reverse Transcriptase enzyme, RNase inhibitor, and necessary buffers and reagents for the cDNA synthesis reaction.
Automatically generated - may contain errors
3 protocols using revertaid first strand cdna synthesizing kit
1
Isolation and Characterization of SbDhn1 from Sorghum
2
RNA Extraction and RT-PCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on TRIzol reagent (Invitrogen, Carlsbad, CA, USA), overall RNA received the extraction in tissues or cells under culture. RevertAid First-Strand cDNA Synthesizing kit (Thermo Scientific) was employed to achieve the reverse transcribing process. RT-PCR was performed using ABI Prism 7900HT (Applied Biosystems, Guangzhou, Guangdong, China) following the reagents’ orientation. GAPDH and U6 became inner standard using 2−ΔΔCt approach. Table 1 lists the sequences of the primers.
The primers used in this study for RT-PCR
| Names | Sequences (5ʹ-3ʹ) |
|---|---|
| SND1-IT1: F | ACGCCAGCACATCTGCTGCAC |
| SND1-IT1: R | GTCGAACGGTCCAGCTCAC |
| miR-132-3p: F | GCGCGCGTAACAGTCTACAGC |
| miR-132-3p: R | GTCGTATCCAGTGCAGGGTCC |
| SMAD2: F | CGTCCATCTTGCCATTCACG |
| SMAD2: R | CTCAAGCTCATCTAATCGTCCTG |
| GAPDH: F | GGAGCGAGATCCCTCCAAAAT |
| GAPDH: R | GGCTGTTGTCATACTTCTCATGG |
| U6: F | ATTGGAACGATACAGAGAAGATT |
| U6: R | GGAACGCTTCACGAATTTG |
3
Semi-Quantitative RT-PCR Analysis of Plant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 100 mg leaf tissue (collected at different time points post-inoculation) using the RNeasy Plant Mini Kit (Qiagen, Germany) following the manufacturer’s protocol. First-strand cDNA synthesis was done from 1 µg of total RNA using RevertAid First-strand cDNA synthesizing kit [Thermo Scientific, (EU) Lithuania] according to the manufacturer’s instruction using an oligo-dT primer. The genes targeted for the semi-quantitative RT-PCR analysis and the primers used for the amplification of those genes are enlisted in the Supplementary Table S1. Actin was used as an internal control to normalize the sample amounts.
The semi-qRT-PCR was carried out in MJ Mini Personal Thermo Cycler (Bio-Rad, USA). The PCR cycling conditions were as follows: 95 °C for 2 min, followed by 35 cycles of 95 °C for 20 s, 55 °C for 20 s and 72 °C for 20 s; a final extension for 5 min at 72 °C was given at the end of the PCR reaction.
The semi-qRT-PCR was carried out in MJ Mini Personal Thermo Cycler (Bio-Rad, USA). The PCR cycling conditions were as follows: 95 °C for 2 min, followed by 35 cycles of 95 °C for 20 s, 55 °C for 20 s and 72 °C for 20 s; a final extension for 5 min at 72 °C was given at the end of the PCR reaction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!