Nitrocellulose filter

For whole cell lysate, the cells were harvested and suspended in 120 μl of RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1.5% NP40, 0.5% deoxycholate, 2 mM MgCl₂) containing protease inhibitors (protease inhibitor cocktail 1:500, 10 μg/ml leupeptin, 5 μg/ml pepstatin A, 25 μg/ml ALLN, 1 mM PMSF and 10 μM MG-132). Protein concentrations of the extracts were determined with Pierce BCA protein assay kit (ThermoFisher, 23225), then mixed with 4×SDS loading buffer (150 mM Tris-HCl, pH 6.8, 12% SDS, 30% glycerol, 0.02% bromophenol blue, 6% β-mercaptoethanol). Proteins were separated with SDS-PAGE, transferred to nitrocellulose filters (GE Healthcare). Immunoblots were blocked by 5% non-fat milk/TBST and probed with indicated primary and HRP-conjugated secondary antibodies. Images were captured with Amersham Imager 680 (GE Healthcare), and intensities of each band were quantified by Image-Pro Plus 6 software (Media Cybernetics).

One μL of serum, 15 μg of whole cell lysate, 16 μL of concentrated culture media of HepG2 or 10 μL of lipoprotein solution were heated to 70 °C for 15 minutes in SDS gel-loading buffer, and applied to SDS gel electrophoresis, thereafter proteins were transferred to nitrocellulose filters (GE Healthcare, Little Chalfont, UK). The blots were incubated with rabbit anti-ApoL1 antibody (SIGMA, MO, USA) or rabbit anti-human GAPDH antibody (Abcam, Cambridge, UK), followed by incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG (IBL, Gunma, Japan). Signal intensity of ApoL1 was measured by Image J.

Conjugation experiments were carried out in blood heart infusion broth (Oxoid, Hampshire, United Kingdom) and on nitrocellulose filters (GE Life Science, Pittsburgh, PA, United States) at both 30 and 37° as described previously (Coque et al., 2002 (link); Novais et al., 2006 (link); Valenzuela et al., 2007 (link)). An azide-resistant Escherichia coli strain J53 was used as the recipient. For the broth method, the donor and recipient were mixed at a ratio of 1:10 and the mixture was incubated overnight. For the filter method, the donor and recipient were mixed at a ratio of 1:1 and the mixture was incubated for 4 h. Transconjugants were then selected on LB agar plates containing 4 μg/ml meropenem and 150 μg/ml azide.

Conjugation experiments were carried out in blood heart infusion broth (Oxoid, Hampshire, United Kingdom) and on nitrocellulose filters (GE Life Science, Pittsburgh, PA, United States) at both 30°C and 37°C, as described previously (24 (link)). Sodium azide-resistant E. coli strain J53 was used as the recipient. For the broth method, the donor and recipient were mixed at a ratio of 1:10, and the mixture was incubated overnight. For the filter method, the donor and recipient were mixed at a ratio of 1:1, and the mixture was incubated for 4 h. Transconjugants were selected on LB agar plates containing 2 μg/ml meropenem and 150 μg/ml sodium azide or on LB agar plates containing 16/4 μg/ml piperacillin-tazobactam and 150 μg/ml sodium azide. Strain 015625, containing conjugative plasmid pCTXM65_015625 (25 (link)), served as a positive control, and suspected transconjugants were confirmed by PCR with primers F33L/R, 5′-CCGAAAAGGTAATCCTCTGA/ACAAACAGGCAAGAATGTGA, CTXMF/R, 5′-AGTGCAACGGATGATGTTCG/TTCTGCCAGCGTCATTGTG, and J53-unique1F/R, 5′-ACGGACTAACAGCCTGGAAA/TAGCGTATCCAGCGTCACTT.

Whole-cell extracts (5 mg total protein) were prepared in lysis buffer (50 mM Tris/HCl pH 7.5, 0.5% sodium deoxicholate, 150 mM NaCl, 1% NP-40 and protease inhibitor (Sigma-Aldrich), and incubated with anti-HA monoclonal antibody (12CA5; Roche Molecular Biochemicals) and protein A sepharose beads for 4 h at 4 °C. The beads were washed two times with lysis buffer, two times with washing buffer 2 (50 mM Tris/HCl pH 7.5, 0.05% sodium deoxicholate, 500 mM NaCl, 0.1% NP-40), one time with washing buffer 3 (50 mM Tris/HCl pH 7.5, 0.05% sodium deoxicholate, 0.1% NP-40), and resuspended in sample buffer. Proteins were separated by SDS-PAGE, transferred to nitrocellulose filters (GE Healthcare), and hybridized with either mouse monoclonal anti-HA antibody (Pmk1–HA fusions; clone 12CA5; Roche Molecular Biochemicals), or anti-GFP antibody (Pek1–GFP fusions; Roche Molecular Biochemicals), followed by immunodetection with anti-mouse peroxidase-conjugated secondary antibody (Sigma-Aldrich), and the ECL system (GE Healthcare).