Topo xl pcr cloning kit

To sequence the ~12-kb long-range PCR product, the PCR product was first purified from an agarose gel using the reagents supplied in the TOPO® XL PCR cloning kit (ThermoFisher Scientific, Wilmington, DE) following the manufacturer’s instructions. The PCR product was sequenced using an ABI3500 XL Genetic Analyzer (Applied Biosystems, Foster City, CA) using the primer walking approach. In that approach, the first sequencing reaction was conducted using the PCR primers as the sequencing primers, and new primers were designed based on the newly read sequences (Table S2).
The sequences generated have been deposited at GenBank under the accession number MH341450.

Genomic DNA was isolated from B-cell clones with a commercial kit (QIAGEN). For
analysis of the camel-like antibody MGB47, 3’RACE22 (link) with the CH2-γ-REV1 primer (gagaccttgcacttgtactccttgcc) was used for
amplification of truncated heavy chain mRNAs. Heavy-chain variable to constant gDNA of
MGB47 was amplified using an upstream 5’ VH3-21 primer
(gggtccatattgtgatcctgagtctggg) and CH2-γ-REV1 as the reverse primer. After PCR
amplification with LongAmp Taq Polymerase (New England Biolabs), the 6000bp amplicon was
cloned into a vector using the TOPO XL PCR cloning kit (ThermoFisher) and sequenced by
plasmid-NGS-sequencing (Microsynth, Switzerland). All other LAIR1 switch and V-DJ inserts
were analyzed by PCR amplification of gDNA and Sanger Sequencing using donor-specific
forward and universal reverse primers: donE_FW (cctggagggtcttctgcttgctggc), donF_FW
(cctcctgctggtggcagctccc), donJ/M_FW1 (atggagtttgggctgagctgggttttcc), donJ_FW2
(gtgagtgaacacgagtgagagaaacagtgg), donM_FW2 (gagtgaacatgagtgagaaaaactggatttgtgtgg),
donO/Q_FW (atgaaacatctgtggttctt), 3’J6_REV (ggcatcggaaaatccacagaggctcc),
IgG_CH1_REV1 (tcttgtccaccttggtgttgct), IgG_CH1_REV2 (gtagtccttgaccaggcagc), IgM_CH2_REV1
(ggacacctgaatctgccggggactgaaaccc), and IgM_CH2_REV2 (ctggtcaccttgtaggtcgtgggcccag).