Conventional RT-PCR products were subjected to automatic gel electrophoresis on QIAxcel Advanced System (QIAGEN). Nucleotide sequences were obtained by Sanger sequencing using Mix2Seq Kits (Eurofins Genomics, Ebersberg, Germany), identified by BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi , accessed on 29 March 2023), and aligned using BioEdit Sequence Alignment Editor version 7.2.5. The phylogenetic tree was created in MEGA X [51 (link)], using the Jukes–Cantor and p-distance methods with 1000 bootstrap replicates.
Mix2seq kit
Manufactured by Eurofins
Sourced in Germany, Luxembourg
The Mix2Seq kit is a laboratory product designed for DNA sample preparation. It enables the simultaneous sequencing of multiple DNA samples in a single reaction. The core function of the kit is to facilitate efficient and streamlined DNA sequencing workflows.
Automatically generated - may contain errors
Lab products found in correlation
Nucleospin plasmid easypure kit, by Macherey-Nagel (3 mentions)
Qiaxcel advanced system, by Qiagen (2 mentions)
Genejet gel extraction kit, by Thermo Fisher Scientific (2 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions)
Q5 high fidelity 2 master mix, by New England Biolabs (2 mentions)
Nebuilder hifi dna assembly master mix, by New England Biolabs (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Microplate reader, by Thermo Fisher Scientific (2 mentions)
Pcr kleen spin columns, by Bio-Rad (1 mentions)
Q5 dna polymerase, by New England Biolabs (1 mentions)
Phusion dna polymerase, by New England Biolabs (1 mentions)
Quickextract dna extraction solution, by Illumina (1 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Geneticin g418, by Thermo Fisher Scientific (1 mentions)
Plat e cell line, by Cell Biolabs (1 mentions)
Zymopure 2 plasmid maxiprep kit, by Zymo Research (1 mentions)
Polybrene, by Merck Group (1 mentions)
Innuprep dna mini kit, by Analytik Jena (1 mentions)
Custom dna oligos, by Eurofins (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
41 protocols using mix2seq kit
1
Phylogenetic Analysis of Sequenced Amplicons
2
Genomic Sequencing and Phylogenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Conventional (RT-)PCR products were examined by automatic gel electrophoresis on QIAxcel Advanced System (QIAGEN). Before sequencing, most amplicons were purified using PCR Kleen Spin Columns (Bio-Rad, Hercules, CA, USA), according to the manufacturer’s instructions. Nucleotide sequences were obtained by Sanger sequencing using Mix2Seq Kits (Eurofins Genomics, Ebersberg, Germany), and identified by BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi , accessed on 22 June 2022).
The phylogenetic trees were constructed based on a short fragment that was created by a nested PCR using degenerate primers targeting a conserved region of herpesviral DNA polymerase genes (Table 1 ), and a 239-bp fragment of the cytochrome b gene (cytb), with the respective primers located at positions 250 and 488 of cytb [41 (link),43 ] (Table 2 ). In total, 41 sequences were generated: 26 herpesvirus and 15 rodent sequences. ClustalW multiple sequence alignments were conducted using BioEdit Alignment Editor Version 7.0.9.0. The phylogenetic trees were created in MEGA X [45 (link)], applying the neighbor-joining and p-distance methods with 1000 bootstrap replicates.
The phylogenetic trees were constructed based on a short fragment that was created by a nested PCR using degenerate primers targeting a conserved region of herpesviral DNA polymerase genes (
3
Exon 9 Sequencing of IL6R Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the buffy coat collected from patients and controls using the standard phenol-chloroform method. IL6R exon 9 sequence (chr1:154,426,802–154,427,232-GRCh37/hg19) was amplified by PCR using the DreamTaq™ Hot Start PCR Master Mix (Cat. N. K9011-Thermo Fisher Scientific™, Waltham, MA, USA). The primers and amplification conditions were as follows: Fw: 5′-TGTTGGTTGGCAGAGCTGTT-3′ and Rev: 5′-CACCTAAAACACGGCTTGGC-3′; 1 cycle of 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 90 s, followed by 1 cycle of 72 °C for 10 min.
The PCR product was purified with the GeneJET PCR Purification Kit (Cat. No. K0702-Thermo Fisher Scientific™, Waltham, MA USA) and sequenced with the Mix2Seq Kits (Eurofins Genomics, Germany GmbH, Ebersberg, Germany) according to the manufacturer’s instructions. The obtained sequences were compared to the NCBI reference sequences to identify any polymorphic variants within the Exon 9 of the IL6R gene. The analysis of DNA sequences was performed by Chromas Lite software version 2.6.6 (accessed on 18 January 2022—technelysium.com.au/wp/) (Technelysium Pty Ltd., South Brisbane, Brisbane, Australia).
The PCR product was purified with the GeneJET PCR Purification Kit (Cat. No. K0702-Thermo Fisher Scientific™, Waltham, MA USA) and sequenced with the Mix2Seq Kits (Eurofins Genomics, Germany GmbH, Ebersberg, Germany) according to the manufacturer’s instructions. The obtained sequences were compared to the NCBI reference sequences to identify any polymorphic variants within the Exon 9 of the IL6R gene. The analysis of DNA sequences was performed by Chromas Lite software version 2.6.6 (accessed on 18 January 2022—technelysium.com.au/wp/) (Technelysium Pty Ltd., South Brisbane, Brisbane, Australia).
4
Sanger Sequencing of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protocol provided with the Eurofins Mix2Seq kit was followed for Sanger sequencing PCR products. According to the protocol, 15 μL purified PCR product (1–15 ng/μL) was mixed with 2 μL of either forward or reverse primer stock solution (10 pmol/μL). 17 μL DNA/primer mix was pipetted into a Mix2Seq tube and sent to Eurofins, Wolverhampton, U.K. for sequencing. Sequence data, obtained online in fasta format, was analysed using Clone Manager Professional Suite.
5
Genotyping using KASP Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides for KASP analysis contained the standard FAM or HEX compatible tails (FAM tail, 5′-GAAGGTGACCAAGTTCATGCT-3′; HEX tail, 5′-GAAGGTCGGAGTCAACGGATT-3′). Oligonucleotide sequences for the KASP analyses of the mutations identified from the exome capture and those used to examine chromosome 1D mutations are provided in tables S13 and S14, respectively. The KASP assay was performed as described previously (10 (link)). DNA fragments were amplified by PCR, using either Phusion DNA polymerase (NEB, USA) or Q5 DNA polymerase (NEB), using oligonucleotides provided in table S15. PCR amplicons were sequenced using the Mix2Seq kit (Eurofins, Germany).
6
Cloning Terpene Synthase Genes in Cyanobacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pC-derived replicative plasmids for high-level expression of terpene synthase genes (Table S1 ) were introduced in S.7942 and S.7002 by conjugation, as described [19 (link),20 (link)], using a 72 h co-incubation of E. coli and cyanobacterial cells. The DNA cassettes for high-level expression of terpene synthase genes were introduced in neutral sites of the chromosome of S.7942 or S.7002 by transformation, as described [21 (link),22 (link)]. Cells were then plated on MM containing Km 50 μg·mL−1 or both Sp 5 μg·mL−1 and Sm 5 μg·mL−1 (S.7942), or A+ medium containing 4 μg·L−1 B12 vitamin, 3 g·L−1 sodium thiosulfate, Km 50 μg·mL−1 or both Sp 50 μg·mL−1 and Sm 50 μg·mL−1 (S.7002), which were solidified with 1% (S.7942) or 1.5% (S.7002) Bacto Agar (Difco).
The presence of the terpene-synthase-encoding DNA cassette propagated in pC-derived plasmids or a neutral chromosomal site was verified by PCR and DNA sequencing (Mix2Seq Kit, Eurofins Genomics) using appropriate oligonucleotide primers (Table S2 ).
The presence of the terpene-synthase-encoding DNA cassette propagated in pC-derived plasmids or a neutral chromosomal site was verified by PCR and DNA sequencing (Mix2Seq Kit, Eurofins Genomics) using appropriate oligonucleotide primers (
7
Genomic DNA Extraction and Cloning in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloning in E. coli was performed essentially as described in Sambrook and Russel (2001 ). Genomic DNA from B. licheniformis was isolated as previously described (Nahrstedt et al. 2004 (link)) or by using a commercially available kit (GeneJET Plasmid Miniprep Kit, Thermo Fisher Scientific Inc., Waltham, USA; QuickExtract™ DNA Extraction Solution, Epicentre®, Madison, USA). Plasmid DNA was purified with the GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific Inc., Waltham, USA). For in vitro amplification of DNA, PCR samples (100 µl) contained 200 µM dNTPs, 100 ng template DNA, 1 pmol of each primer and 1 U Taq, Q5 (New England Biolabs GmbH, Frankfurt a.M., Germany) or the Phusion DNA polymerase (Finnzymes Thermo Fisher Scientific Inc., Waltham, USA). Purification of amplified or restriction fragments from gels was performed applying a GeneJET Gel Extraction Kit (Thermo Fisher Scientific Inc., Waltham, USA). Nucleotide sequences were determined by Eurofins Genomics with the didesoxy chain-termination method (Sanger et al. 1977 (link)) using the Mix2Seq kit (Eurofins Genomics GmbH, Ebersberg, Germany).
8
Plasmid DNA Sequencing and Genome Resequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA was sequenced using the Mix2SeqKit (Eurofins Genomics, Ebersberg, Germany). The genomes of JG1295 and JG991 were resequenced using an Illumina MiSeq with v2 chemistry (Illumina, San Diego, CA, USA) with 2 × 250 bp reads for the variant analysis. The library was created using the NEBNext® Ultra™ II FS DNA kit. Illumina sequencing was carried out by IMGM Laboratories GmbH (Martinsried, Germany).
9
Retroviral Transduction of Il22ra2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Murine Il22ra2 (IL22-BP) cDNA was purchased from GeneScript. DNA insert was cloned into the retroviral pMSCV-Neo plasmid (Clontech) following standard molecular cloning protocols.124 (link) Constructs were verified by Sanger sequencing using the Mix2Seq kit (Eurofins) according to the manufacturer’s instructions. The validated plasmid was expanded in competent E. coli DH5α (NEB) and purified using Zymo Pure II Plasmid Maxiprep Kit (Zymo Research). For retroviral expression, pMCSVn-Neo and pMCSVn-Neo-Il22ra2 plasmids were transfected into the PLAT-E cell line (Platinum-E retroviral packaging cell line, Cell Biolabs) using Lipofectamine 2000 transfection as described. After 48 h supernatant containing viral particles was collected and filtered using a 0.45 μm filter. Two mL of fresh viral supernatant that contained 8 μg/mL polybrene (Sigma-Aldrich) was added to 4T1 or Line-1 target cells followed by centrifugation at 800 g for 30 min at 32°C and incubated for 24 h. Then the medium was exchanged to RPMI and incubated for an additional 24 h for a total of 48 h. Transduced cells were selected with the addition of 800 μg/mL of Geneticin G418 (Thermofisher) for two weeks.
10
Genomic DNA Isolation and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated with the innuPREP DNA Mini Kit (Analytik Jena, Jena, Germany). PCRs were run under standard conditions (Hasselmann and Beye 2004 (link)) using Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and oligonucleotide primers (forward primer: GATTCGTAATAATTCCTGTGC; reverse primer: CTTCCGCTACTCTTACTTTGAC; Custom DNA Oligos, Eurofins). For the Sanger sequencing (Mix2Seq Kit, Eurofins) amplicons were cloned into pGEM-T Easy Vector (Promega, Madison, WI).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!