5 deadenylase

Total RNA was extracted from ground animals with trizol, resuspended in TE 7.4, and quantified using the Qubit HS RNA kit. No poly(A) selection nor ribosome subtraction was performed. 1ug of RNA was used as input for 3′ RACE library preparation. For ‘3′ OH + 3′ P 3′ RACE’, total RNA was first treated with T4 PNK (NEB) to remove 3′ phosphates. The T4 PNK reaction was cleaned up with phenol/chloroform extraction followed by RNA precipitation, and then used in ligation. For ‘3′ OH 3′ RACE’ libraries, total RNA was directly used in ligation. Volumes and conditions were per similar, published protocols (16 ). Preadenylated adaptor (AF-JA-34: /5rApp/NNNNNNAGATCGGAAGAGCACACGTCT/3ddC/) was ligated to RNA 3′ ends using T4 RNA Ligase 1 (NEB). Unligated adaptor was cleaned up using sequential 5′ deadenylase (NEB) and RecJ treatment (NEB). Ligated RNA samples were run on a urea 15% polyacrylamide gel and the ligated species was excised from the gel, eluted, and precipitated. Reverse transcription was performed using AF-JA-126 (/5Phos/AGATCGGAAGAGCGTCGTGT/iSp18/CACTCA/iSp18/GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) as the primer and Superscript II RT (Thermo Fisher). cDNA was size-selected on a urea 10% polyacrylamide gel purified, and then circularized with circligase (Lucigen). PCR was performed to add illumina adaptors and barcodes for sequencing.

RNA was mixed with 50 μl of 10 × T4 PNK buffer (5 μl), 10 mM ATP (5 μl), 10 U/μl T4 PNK (2 μl, NEB, M0201), 40 U/μl Ribolock RNase inhibitor (RRI; 1 μl, Thermo Fisher, EO0384) and nuclease-free water (37 μl, Thermo Fisher, AM9938) and incubated at 37 °C for 1 h. T4 PNK-treated RNA (2 μg) was ligated to 3’ adapters directly in the ligation mixture (2 μl of 10 × T4 RNA ligase reaction buffer, 5 μl of 50% PEG 8000 MW, 1 μl of 200 U/μl T4 RNA Ligase 2, truncated KQand 1 μl of RRI) at 16 °C for 18 h. To remove the unligated 3’ adapters, we added (1) 2 μl of 50 U/μl 5’ Deadenylase (NEB, M0331), with incubation for 1 h at 30 °C; (2) 0.44 μl of 30 U/μl E. coli single-stranded binding protein (Promega, M3011), with incubation on ice for 30 min; and (3) 2 μl of 30 U/μl RecJf exonuclease (NEB, M0246), with incubation at 37 °C for 1 h. Then, 5’ adapter ligation buffer (2 μl of 10 × T4 RNA ligase reaction buffer, 4 μl of 10 mM adenosine-5’-triphosphate, 1 μl of 10 U/μl T4 RNA ligase 1 (NEB, M0204) and 1 μl of RRI) was added to the mixture above and reacted at 16 °C for 18 h to obtain the best ligation efficiency.

RNA samples, typically 100 ng for DMSO and 1000 ng for NAI-N₃ or NAz-N₃ modified RNA, were first dried with a lyophilizer (Labconco) and brought back up 9 μl water. RNA was fragmented by adding 1 μl of Fragmentation Reagent (Ambion) at 70°C for 30 s and then stopped by adding 1 μl of RNA Fragmentation Stop Solution (Ambion) and moved to ice. RNA was desalted with a Zymo RNA clean and concentrator as above and again dried with a lyophilizer. End repair occurred by adding 5 μl of water, 2 μl of 5x PNK buffer (350 mM Tris–HCl pH 6.5, 50 mM MgCl₂, 25 mM DTT), 0.5 μl SUPERaseIn (Thermo Fisher Scientific), and 1.5 μl of T4 PNK (NEB) and 1.5 μl Fast AP (Thermo Fisher Scientific). These reactions were incubated at 37°C for 45 min. After end-repair, 1 μl of 2 μM 3′ pre-adenylated adaptor (3′biotin linker for DMSO or 3′dideoxycytosine linker for NAI-N₃ or NAz-N₃), 1 μl of 10× T4 RNA Ligase I buffer (NEB), 1 μl T4 RNA Ligase, High Concentration (NEB), 1 μl of 100 mM DTT and 6 μl of 50% PEG8000 were added. Ligation reactions were incubated at 25°C for 6 h. Excess, unligated adaptors were destroyed enzymatically by adding 3 μl of 10× NEB Buffer 2 (NEB), 2 μl Rec Jf (NEB), 1 μl 5′ deadenylase (NEB), 4 μl of water and incubate at 37°C for 1 h. Ligated RNA products were desalted and removed of enzymes with the Zymo RNA clean and concentrator.

m⁶A-SAC-seq was performed following the previously published procedure^{36 (link)}. Briefly, 50 ng of K562 caRNA and RBFOX2-bound RNA were fragmented with RNA Fragmentation Reagents (Thermo Fisher Scientific, AM8740) at 70 °C for 5 min, followed by end repair with T4 Polynucleotide Kinase (New England Biolabs, M0201) at 37 °C for 1 h. Next, spike-in mix was added, and ligation of RNA 3′ biotinylated adaptor was performed by using T4 RNA ligase 2, truncated KQ (New England Biolabs, M0373). Excess adaptors were digested with 5′ deadenylase (New England Biolabs) and RecJ (New England Biolabs). RNAs were enriched by Dynabead MyOn Streptavidin C1 beads (Thermo Fisher Scientific, 65001) following the manufacturer’s instructions, and labelled by Mjdim1 with allyl-SAM for two rounds at 50 °C for 1 h, followed by iodine labelling at room temperature for another 1 h. Reverse transcription was carried out with recombinant HIV reverse transcriptase (Worthington Biochemical, LS05006) at 37 °C for 2 h, and template RNAs were digested with RNase H (New England Biolabs). The libraries were prepared by complementary DNA adaptor ligation with T4 RNA ligase 1, high concentration (New England Biolabs) and PCR amplification with NEBNext Multiplex Oligos for Illumina (New England Biolabs).