Sensifast kit

From human samples, 30 mg of tissue was homogenized in RLT buffer containing β-mercaptoethanol. Complementary DNA (cDNA) was manufactured using the SENSIFast kit (Bioline) using 1 μg mRNA, as per the manufacturer’s instructions. From the cell lines, mRNA was purified using RNeasy kits (Qiagen, Manchester, UK) as per the manufacturer’s instructions. mRNA samples were reverse transcribed to form cDNA using the Tetro cDNA Synthesis Kit (Bioline Reagents Ltd., London, UK).
Expression of specific mRNAs was determined on a 7500 real-time polymerase chain reaction system (Applied Biosystems) using the QuantiTect Probe reverse transcription polymerase chain reaction kit (Qiagen). Relative expression was determined using the 2^−∆∆Ct method. The Taqman assays are described in Supplemental Table 2.

Chimeric RNA candidates predicted by EricScript (31 (link)) were confirmed by qRT-PCR. All RNA samples in this study were treated with DNase I (NEB, M0303), and followed by reverse transcription using the SensiFAST kit (Bioline, BIO-65054). qPCR was performed using the Applied Biosciences StepOne Plus system (Life Technologies) with the SensiFAST SYBR with HiRox reagent (Bioline, BIO-92005). Following qRT-PCR and gel electrophoresis, purified DNA bands were sent to Genewiz for Sanger sequencing. In knockdown experiments, the 2^−ΔCt method was used to compare relative RNA expression between samples. All qRT-PCR primers are listed in Supplementary Table S1.

The impact of RRF on the gene expression of COX-2, iNOS, IL-6, TNF-α, and NF-κB in LPS-induced PBMC was studied [62 (link)]. In brief, after overnight culturing 2 × 10⁶ cells/mL of PBMCs in RPMI 1640 medium, they were treated with 100 μL LPS (20 ng/mL), in the presence and absence of 0.5 IC₅₀ of RRF, for another 24 h. The effect on the gene expressions of COX-2, iNOS, IL-6, TNF-α, and NF-κB was assessed by qRT-PCR (used primers are presented in Table S3) in the LPS-treated cells and the LPS -untreated cells (untreated control). A RNeasy mini kit (Qiagen, Hilden, Germany) was used for the extraction of the total RNA from PBMCs. Then, RNA was converted into complementary DNA (cDNA) using the SensiFAST™ kit (Bioline, London, UK). The utilized housekeeping gene was GAPDH, and the utilized RT-PCR master mix was SensiFAST™ SYBR green (Bioline, London, UK). The 2^−ΔΔCT method was utilized for the calculation of the gene expression fold change [63 (link)].

Total RNA was extracted from roots of 10-day-old Arabidopsis WT (Col-0) with TRIZOL reagent (Life Technologies, Mulgrave, VIC, Australia) according to Chen et al. (2015b ) and Liu et al. (2014) (link). RNA was reverse transcribed with a sensiFAST Kit (Bioline, Alexandria, NSW, Australia) and real-time PCR was performed with a SensiMix SYBR No-ROX Kit (Bioline, Alexandria, NSW, Australia) using a Rotor-Gene Q6000 (QIAGEN, Hilden, Germany). The gene-specific primers are as below: forward 5'-CACTATGGCAACTGTCGGTTATGG-3' and reverse 5'-GCGGTTCATGAAACTTATGAGATC-3' for GORK; and forward 5'-TGCGGGTGCCCATTTAAC-3' and reverse 5'-CTTTCACAAACCACCAGTAGC-3' for RBOHD. Amplification of the RNA polymerase II subunit (RPB2) (forward primer 5'-TTCCCCGTTCCGATAACT-3' and reverse primer 5'-ATGCTCTGCCGTCCACC-3') gene was used as an internal control. The PCR program was two steps: one cycle of 95 °C, 10 min; 40 cycles of 95 °C, 15 s; 60 °C, 15 s; 72 °C, 15 s. The amplification of the target genes was monitored every cycle by SYBR-green fluorescence. Three biological and three technical replicates were performed for each treatment.

For qPCR of Klf4 and Elf3, 0.5 ug RNA (WT n = 11, TG n = 7) was transcribed to cDNA using the SensiFAST Kit (Bioline, Cincinnati, OH, US)). 0.1 ng/well of template cDNA was amplified using SYBR Green DyNamo HS Flash qPCR Kit (Thermo Fisher Scientific, Carlsbad, CA, USA). The primer sequencies were as follows: Klf4 (forward 5′ -> 3′ TACCCTCCTTTCCTGCCAGA and reverse 5′ → 3′ CGGTAGTGCCTGGTCAGTTC, T_m = 60.0), Elf3 (forward 5′ → 3′ CGGTGGAAGTGATGTGGACC and reverse 5′ → 3′ GTTCCAGGATCTCCCGTTTGT, T_m = 60.0).