Superscript 3 reverse transcription system

Total RNA from rat cortical cultures was purified using TRIzol (Thermo Fisher Scientific; cat. # 12183555) and reverse-transcribed using the SuperScript III Reverse Transcription System (Thermo Fisher Scientific; cat. # 12574035). The optical density A260/A280 ratio was confirmed to be >1.9 for each sample. For N-cadherin, we used the following oligonucleotides: 5′-ATCATTCGCCAAGAGGAAGG-3′ and 5′-GGCTGAAAATAGACCCTGTGA-3′. Quantitative real-time PCR was performed with a 7300 real-time PCR system (Applied Biosystems, Foster City, CA) using Power SYBR Green Master Mix (Applied Biosystems; cat. # 4367659) with the following PCR conditions: initial hold at 95°C for 10 min, followed by 40 cycles of a 15-s denaturing step at 95°C and a 60-s annealing and extension step at 60°C. Transcript levels were normalized to the housekeeping gene GAPDH using the following oligonucleotides: 5′-CCATCAACGACCCCTTCATT-3′ and 5′-CTGAGAATGGGAAGCTGGTC-3′.

Total RNA was extracted from ependymal cells with the RNeasy Midi Kit (Qiagen), according to the manufacturer’s instructions, at different time points during differentiation in vitro. RNA was converted into single-stranded cDNA using the Superscript-III Reverse Transcription System (ThermoFisher) with random primers, according to the manufacturer’s instructions. The following primers were used for subsequent PCR amplification: the housekeeping gene CyclophilinA Fw primer 5′-ACCCCACCGTGTTCTTCGAC-3′ and Rev primer 5′-CATTTGCCATGGACAAGATG-3′ for normalisation; the Cobl Fw primer 5′-TGAGATCCAAGGACAAATGG-3′ and Rev primer 5′-CTCATCTCTGATTTGGGAGG-3′. CyclophilinA and Cobl were amplified simultaneously by PCR in the same tube and the products subjected to agarose gel electrophoresis. Band intensities were quantified with ImageJ software and normalised with respect to cyclophilinA.

The total RNA was homogenized in TRIzol and isolated from mouse kidneys or human plasma according to the manufacturer's protocol. Reverse transcription was performed using the Superscript III Reverse Transcription System (Invitrogen) for mRNA or PrimeScript RT reagent Kit for miRNA, and real‐time PCR analysis was performed using SYBR Green or Taqman quantitative kit (Applied Biosystems, Alameda, CA). The sequence of primers for detecting mRNA was listed as following: TNF‐α: F‐5ʹ‐ACGGCATGGATCTCAAAGAC‐3ʹ; R‐5ʹ‐AGATAGCAAATCGGCTGACG‐3ʹ, IL‐6: F‐5ʹ‐GTCCTTCCTACCCCAATTTCCA‐3ʹ; R‐5ʹ‐TAACGCACTAGGTTTGCCGA‐3ʹ,iNOS: F‐5ʹ‐CCAAGCCCTCACCTACTTCC‐3ʹ; R‐5ʹ‐CTCTGAGGGCTGACACAAGG‐3ʹ, MCP‐1: F‐5ʹ‐CCACTCACCTGCTGCTACTCA‐3ʹ; R‐5ʹ‐TGGTGATCCTCTTGTAGCTCTCC‐3ʹ,NRF: F‐5ʹ‐AGAAAGATGGGTTGGACT‐3ʹ; R‐5ʹ‐CTGTGTGGCTCTCGGA‐3ʹ, GAPDH: F‐5ʹ‐AGGAGCGAGACCCCACTAAC‐3ʹ; R‐5ʹ‐GATGACCCTTTTGGCTCCAC‐3ʹ. Relative mRNA levels were normalized to GAPDH level. For miRNA expression analysis, 150 ng total RNA was reverse‐transcribed into cDNA using miRNA‐specific primers supplied with TaqMan MicroRNA Reverse Transcription kit. The quantitative real‐time PCR was performed using the ABI Prism 7000 instrument (Applied Biosystems). Small nucleolar RNA 202 (Sno202) was used as an internal control for comparison of relative changes in miRNA.

Trizol reagent (Invitrogen) was used to isolate total RNA. cDNA was made using Superscript III reverse transcription system (Invitrogen) from 1 μg RNA. Quantitative real-time PCR (qRT-PCR) was performed using a Bio-Rad CFX96 system with SYBR green to determine the interested mRNA expression. Primers are as follows:
Nanog (forward), 5′- TTTGTGGGCCTGAAGAAAACT-3′;
Nanog (reverse), 5’-AGGGCTGTCCTGAATAAGCAG-3′;
Sox2 (forward), 5’-TGGACAGTTACGCGCACAT -3′;
Sox2 (reverse), 5’-CGAGTAGGACATGCTGTAGGT-3′;
CD44 (forward), 5’-CTGCCGCTTTGCAGGTGTA-3′;
CD44 (reverse), 5’-CATTGTGGGCAAGGTGCTATT-3′;
Ezh2 (forward), 5’-AATCAGAGTACATGCGACTGAGA-3′;
Ezh2 (reverse), 5’-GCTGTATCCTTCGCTGTTTCC-3′;
GAPDH (forward), 5’-AATGGACAACTGGTCGTGGAC-3′;
GAPDH (reverse), 5’-CCCTCCAGGGGATCTGTTTG-3′.