Quantiscript reverse transcriptase

The expression of Bcl2, Survivin, cIAP, XIAP, GCLC (glutamate-cysteine ligase catalytic subunit) and GAPDH was analyzed in MCF-7 and U87 cells after the treatment with PRE, EA, Hex and mixture of EC+GA+UA. Total RNA was extracted from cells using RNAeasy kit (Qiagen GmbH, Hilden Germany). cDNAs were reverse transcribed from 1 μg of total RNA from each sample using Quantiscript Reverse Transcriptase, Quantiscript-RT-buffer and RT-primer-mix of QuantiTect Reverse Transcription kit (Qiagen GmbH, Hilden Germany) according to the manufacturer’s protocol.
Amplification of cDNA was carried out in 20 μl solution containing 2 μl cDNA, 10 pmol primer pairs for Bcl2, Survivin, XIAP, cIAP and GAPDH (for primer sequences- Table A in S1 File) and 10 μl of RT qPCR Master mix (Qiagen GmbH, Hilden, Germany). The PCR consisted of initial denaturation at 94°C for 5 min, followed by 25 reaction cycles (30 seconds at 94°C, 30 seconds at 60°C, and 30 seconds at 72°C) and a final cycle at 72°C for 10 min. GAPDH was used as internal control. The amplified PCR products were separated by agarose gel electrophoresis and visualized with ethydium bromide. The abundance of each target mRNA was detected and normalized to that of GAPDH mRNA.

RNA was extracted from the MDA-MB-231 epithelial, human breast cell line using an RNeasy mini kit (Qiagen, Venlo, Netherlands‎). First-strand cDNA was synthesized from 1 µg of total RNA using 1 µL of Quantiscript Reverse Transcriptase (Qiagen) according to the manufacturer’s protocol. PCR amplification was conducted using the following conditions: 40 cycles of 95 °C for 1 min, 55 °C for 90 s, and 72 °C for 1 min followed by a final incubation at 72 °C for 5 min. Primer sequences for target genes were as follows: cathepsin S forward GGGTACCTCATGTGACAAG and reverse TCACTTCTTCACTGGTCATG, cathepsin L forward ATGAATCCTACACTCATCCTTGC and reverse TCACACAGTGGGGTAGCTGGCTGCTG, cathepsin K forward ATGTGGGGGCTCAAGGTTCTGC and reverse TCACATCTTGGGGAAGCTGGCC, cathepsin V forward ATGAATCTTTCGCTCGTCCTGGC and reverse TCACACATTGGGGTAGCTGGC, and actin forward ATCTGGCACCACACCTTCTACAATGAGCTGCG and reverse CGTCATACTCCTGCTTGCTG ATCCACATCTGC.

Genomic DNA was eliminated from the DNA with a mixture of gDNA Wipeout Buffer and RNPASE free water incubated for 2 min at 42°C. Then, 1 µg of total RNA was reverse transcribed using Quantiscript Reverse Transcriptase for 15 min at 42°C and 3 min at 95°C (Qiagen, Sciences, Maryland, USA).

The validation of RNA-Seq data was carried out on a set of DE genes using the quantitative real-time polymerase chain reaction (qPCR) technique. RNA was extracted from independent biological samples collected at the same stage than the ones used for RNA-Seq analysis. The reverse transcription of RNA samples was performed with the QuantiTect Reverse Transcription Kit (Qiagen) and the Quantiscript Reverse Transcriptase (Qiagen). Specific primers for 15 selected genes were designed with Primer3web version 4.0.0 (Additional file 11: Table S5). qPCR reactions, conditions, and calculation of relative expression values were carried out as in Falginella et al. [63 (link)]. The annealing temperature was 58 °C for all primer pairs except the VviUbiquitin housekeeping gene pair, which annealed at 56 °C. Correlation analysis based on the Pearson Correlation Coefficient (PCC) was carried out between the RNA-seq normalized counts and qPCR relative gene expression (Additional file 11: Table S5, Additional file 12: Figure S6).
qPCR was also carried out to determine the level of expression of selected structural genes of the phenylpropanoid, flavonoid, and terpenoid pathway at each sampling date.

Total RNA was isolated from liver tissue (either fresh or frozen) using RNeasy Mini kit (Qiagen, #74104) and as previously described [39 (link)]. The cDNA was synthesized by reverse transcription of RNA using Quantiscript reverse transcriptase according to the manufacturer's instructions (Qiagen, #205310). Specific primers for Bax, p53, Bcl2, TGFβ1, NFκB, VEGF, MMP9, and TIMP1 genes were designed by the Primer 3 web-based tool based on the published rat sequence (Table 1). lncTuc339, lncHEIH, and lncHOTAIR were obtained from RiboBio (Guangzhou, China). Quantitative real-time PCR (qPCR) was performed using QuantiTect SYBR Green qPCR Master Mix in a StepOnePlus Real-Time PCR system (Applied Biosystems, USA) and reaction cycles as previously described [40 (link)]. The quantities of the critical threshold (Ct) of target genes were normalized with quantities (Ct) of the internal control (β-actin) as previously described [41 (link)]. Levels were expressed relative to normal control samples.