Sensimix sybr

RNA (≥1.0 µg) from PBMC was used for first-strand cDNA synthesis using a Superscript III first-strand synthesis kit (Invitrogen, CA, USA), following the manufacturer’s protocols. Quantitative real-time PCR for mRNA detection was performed using Sensimix SYBR (Bioline, London, UK) on the Light Cycler 480 (Roche, Mannheim, Germany) using standard conditions with hypoxanthine–guanine phosphoribosyltransferase (HPRT) as the reference control.

Next-generation sequencing DNA libraries were loaded on a Bioanalyzer 2100 (Agilent) with High Sensitivity DNA chips to verify fragment size distribution between 200-800 bp. Sample libraries were quantified using a Qubit fluorometer (Invitrogen) and, optionally, by qPCR with KAPA Library Quantification DNA standards (Roche) and SensiMix SYBR (Bioline) before being pooled together. 2 × 81-cycle paired-end sequencing was performed using an Illumina NextSeq500 (FC-404-2002).

Total cellular RNA was prepared from in vitro differentiated neurons (7 days after plating, 10⁷ cells) and mouse brain (half brain) using TriReagent (Sigma). cDNA was prepared using a QuantiTect kit (Qiagen) and amplified in a qPCR reaction using SensiMix SYBR and Fluoroscein Master Mix (Bioline) using primers for Mecp2 (forward: 5′-ACCTTGCCTGAAGGTTGGAC-3′, reverse: 5′-GCAATCAATTCTACTTTAGAGCGAAAA-3′) and control Cyclophilin A (forward: 5′-TCGAGCTCTGAGCACTGGAG-3′, reverse: 5′-CATTATGGCGTGTAAAGTCACCA-3′). Samples were run in triplicate and the amount of Mecp2 cDNA calculated for each biological replicate using the ‘double delta’ method after correction of C_T values using a standard curve.

The TriSure cell suspensions were thawed on ice and transferred to zirconium bead prefilled tubes (OPS Diagnostics) and homogenized with a MagNA lyser (Roche Diagnostics). Tissues were homogenized in the MagNA lyser in the presence of TriSure reagent (Bioline). Total RNA was isolated following the manufacturer's protocol. Subsequently, samples were purified using the NucleoSpin RNA Kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's instructions. The cDNA was generated by incubation with random hexamer primers at 70°C, followed by an incubation at 42°C with dNTPs, BioScript reverse transcriptase and 5 × reaction buffer (Bioline).
Quantitative polymerase chain reaction (PCR) was performed in triplicate for each cDNA sample, in the presence of specific primers for Alk4 and SensiMix SYBR (Bioline) with the LightCycler 480 system (Roche Diagnostics). Expression levels of Alk4 were analyzed using the LinReg PCR software (version 2018.0) [19 (link)] and normalized for the expression levels of the housekeeping gene Gapdh. Alk4 forward: CTGTTTGATTATCTGAACCG, Alk4 reverse; AAGTCTCGATGAGCAATTCC, Gapdh forward; TCCATGACAACTTTGGCATTG, Gapdh reverse; TCACGCCACAGCTTTCCA.

NGS libraries of ChrRNA-seq, ATAC-seq, and ChIP-seq samples were loaded on a Bioanalyzer 2100 (Agilent) with High Sensitivity DNA chips to verify fragment size distribution between ~200 and 800 bp. If necessary, additional rounds of clean-up and/or size selection were performed using Agencourt AMPure XP beads (Beckman Coulter) to remove residual adaptors or large (>1000 bp) fragments. Sample libraries were quantified using a Qubit fluorometer (Invitrogen) and pooled together. After pooling, final libraries were quantified by qPCR comparison to previously sequenced NGS libraries using Illumina P5/P7 qPCR primers and SensiMix SYBR (Bioline).
Paired-end sequencing was performed using an Illumina NextSeq500 (ChIP-seq - 2x81bp, 6 bp i7; ATAC-seq - 2x79bp, 8 bp i7).

Chromatin immunoprecipitation (ChIP) assays were performed as described previously (Shah et al., 2014 (link)) and quantified with qPCR using SensiMix SYBR (Bioline). Immunoprecipitations (IPs) were conducted with either rabbit IgG agarose (Sigma) or antibody against Rpb1 (Millipore, 8WG16) coupled to protein G Dynabeads (Life Technologies). The values shown correspond to the ChIP signal above the non-tagged background (for immunoglobulin G [IgG]) over the input relative to a control gene (fbp1). Error bars represent SEM of at least two biological replicates.

For qPCR, total RNA was isolated from 30 embryos per replicate/treatment and the liver of a female adult fish using Trizol (Invitrogen, Karlsruhe, Germany) according to the manufacturer's instructions. RNA integrity was checked by agarose gel electrophoresis. Potential contamination with genomic DNA was removed by treatment with DNAse I (Roche, Grenzach, Germany) for 15 min at 25°C prior to performing the cDNA synthesis. cDNA was synthesized from 2 µg of total RNA using the Fermentas RevertAid kit (Fermentas, Bad Leon-Roth, Germany) and random hexamer primers. cDNA was diluted 4× with ddH₂O. Primers were designed to span introns with the software Beacon Designer 7 (PREMIER Biosoft International, CA, USA). For Primer Sequences see Table S3. The qPCR analysis was performed for two (injected embryos) and three (time course of mRNA levels) independent biological replicates. qPCR was carried out using a StepOnePlus PCR System (Applied Biosystems, Darmstadt, Germany) and we used the SensiMix SYBR with ROX as passive reference (Bioline). Each run was performed with three technical replicates per sample. The reaction conditions: 95°C 15 s, 53°C 20 s, and 72°C 20 s). Expression was normalized against ef1a as reference gene and the normalized relative expression levels were determined by the ΔΔCt method [38] (link).