Qscript kit

Reverse transcription of 200 ng of cytoplasmic RNAs was performed using qScript kit (Quanta Biosciences, Gaithersburg, MD, USA). mRNA quantification was performed by quantitative PCR using a 20 μl reaction, which was prepared with 5 μl of template cDNA (1/10 diluted first), 10 μl of Fast Start Universal SYBR Green Premix (Roche, Bâle, Suisse), 0.2 μM of each primer and subjected to amplification using a StepOne fluorescence thermocycler (Applied Biosystems, Foster City, CA, USA) under the following conditions: 10 min at 94°C for initial denaturation, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s and elongation at 72°C for 30 s. This program was followed by a melting curve analysis in order to verify the specificity of the PCR product. Renilla luciferase (Renilla forward AGGTGAAGTTCGTCGTCCAACATTATC/ Renilla reverse GAAACTTCTTGGCACCTTCAACAATAGC) was amplified in parallel with the endogenous housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (GAPDH forward (Human) TCCACCACCCTGTTGCTGTAG/ GAPDH reverse (Human) ACCCACTCCTCCACCTTTGA). The relative copy numbers of Renilla cDNAs were compared to GAPDH using x^–ΔCt (where x corresponds to the experimentally calculated amplification efficiency of each primer couple).

Total RNA was extracted from cells or serum following the induction of the model using an RNA extraction kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). cDNA was reverse transcribed using a Q-script kit (Quanta Biosciences, Gaithersburg, MD, USA) and a TaqMan miR reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) at 37°C for 1 h followed by 82°C for 10 sec. qPCR was performed using an ABI Prism 7500 Sequence Detection System (Perkin-Elmer Inc., Waltham, MA, USA) and a standard SYBR Green PCR kit (Toyobo Life Science, Osaka, Japan). The temperature protocol was as follows: Initial denaturation at 95°C for 5 min; followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec and elongation at 72°C for 30 sec. Primer sequences were as follows: miR-214, forward, 5′-AGCATAATACAGCAGGCACAGAC-3′ and reverse, 5′-AAAGGTTGTTCTCCACTCTCTCAC-3′; U6, forward, 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse, 5′-GGAACGCTTCACGAATTTG-3′. Results were analyzed using the 2^−ΔΔCq method (12 (link)).