Cd19 cre mice

Ets1 floxed mice have been reported previously (27 (link)) and have been bred to the C57BL/6 genetic background for >12 generations. CD19-Cre mice were obtained from Jackson Laboratory and are on a C57BL/6 background. Conventional Ets1 knockout mice and littermate wild-type controls were bred in our colony and are maintained on a mixed genetic background (C57BL/6 × 129Sv), because of perinatal lethality on a pure C57BL/6 background. Animal experiments were performed under the approval and guidance of the Institutional Animal Care and Use Committee of Roswell Park Cancer Institute.

All animals were housed at Dana-Farber Cancer Institute (DFCI). All animal procedures were completed in accordance with the Guidelines for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committees at DFCI (protocol#:07–068; 12–004). Dnmt3a-floxed mice were gifted from Dr. Ross Levine (MSKCC) (16 (link)). Cd19-Cre^+/− mice were obtained from the Jackson Laboratory (Bar Harbor, ME). Dnmt3a-floxed mice were intercrossed with Cd19-Cre mice to generate Cd19-Cre Dnmt3a-floxed C57BL/6J mice.

Kmt2df/f mice were previously described^{7 (link)} and here we bred them with CD19-Cre mice (Jackson no. 006785) where Cre is expressed from the pre-B cell stage and removes exons 16–19 of Kmt2d causing an open reading frame shift that creates a stop codon in exon 20. Kmt2df/f CD19-Cre mice were maintained in a mixed C57BL/6; 129 background. Mice were monitored for tumor formation once a week for the first 4 months and every day after then. All mice were housed in the Frederick National Laboratory and treated with procedures approved by the NIH Animal Care and Use Committee.
The vavP-Bcl2 mouse model of FL^{9 (link)} was adapted to the adoptive transfer approach using retrovirally transduced HPCs. HPCs isolation and transduction were performed as in³⁰ . 8–10 week old C57BL/6 females lethally irradiated (4.5Gy twice) were used as recipients for all transplantation experiments. Mouse Kmt2d shRNAs were design using Designer of Small Interfering RNA (DSIR, http://biodev.extra.cea.fr/DSIR/) and are based on MSCV³¹

sh-Kmt2d #1 (mouse): GACTGGTCTAGCCGATGTAAA.

sh-Kmt2d #2 (mouse): TGAATCTTTATCTTCAGCAGG

Conditional Lsd1-deficient mice (loxP-flanked Lsd1 allele, Lsd1^fl/fl) were purchased from the Jackson laboratory (023969). By crossing Lsd1^fl/fl with the transgenic Cγ1-Cre strain (The Jackson Laboratory, 010611) we generated heterozygous Cγ1-Cre Lsd1^+/fl mice, which were crossed to yield Cγ1-Cre Lsd1^fl/fl mice. As controls, we used Cγ1-Cre negative Lsd1^fl/fl littermates. B cell conditional Lsd1 deletion was generated by crossing Lsd1^fl/fl mice with CD19-Cre mice (Jackson Laboratory, 006785) where Cre is expressed from the pre-B cell stage. Mice were used for assessment of GC formation induced by immunization with SRBCs, or affinity maturation by immunization with NP-CGG_28–30. We also used IμBcl6 mice (obtained from R. Dalla-Favera, Columbia University^{31 (link)}) to generate IμBcl6 Cγ1-Cre Lsd1^fl/fl by crossing with Cγ1-Cre Lsd1^fl/fl. These mice were used for GC formation assays or bone marrow donors to perform transplantation to C57BL/6 recipients. Animal care and all experiments were performed in strict compliance with the institutional guidelines and protocols of Weill Cornell Medicine and Memorial Sloan-Kettering Cancer Center Institutional Animal Care and Use Committee, the Association for Assessment and Accreditation of Laboratory Animal Care International and in accordance with the GSK Policy on the Care, Welfare and Treatment of Laboratory Animals.

CD19^Cre mice were purchased from the Jackson Laboratory. The dnRARα mice have been previously described (8 (link)). Mice aged 8–10 weeks were immunized with 10 μg of the hapten (4-hydroxy-3-nitrophenyl)acetyl-cholera toxin (NP-CT) (provided by Nils Lycke) as described previously (9 (link)). These studies were approved and conducted in accredited facilities in accordance with the UK Animals (Scientific Procedures) Act 1986 (Home Office license number PPL 70/7102). All animals were co-housed and maintained in a specific pathogen-free facility at King’s College London.