Stepone thermal cycler system

DNA isolation and qPCR were performed as described previously^{24 (link),43 (link)}. EGFP, VEGF Hc, and VEGF Lc were analyzed using specific primers: for EGFP, forward 5′-CTTCTTCAAGTCCGCCATGC-3′, reverse 5′-GGTCTTGTAGTTGCCGTCGT-3′; for VEGF Hc, forward 5′-CTGCACCTGAACTTTTGGGC-3′, reverse 5′-TCGGGTGTACGGGAGATCAT-3′, for VEGF Lc, forward 5′-CAGTACAGTACCGTGCCCTG-3′, reverse 5′-AATACAGATGGGGCTGCGAC-3′. DNA was amplified using an Applied Biosystems StepOne thermal cycler system and a SYBR green PCR kit (Applied Biosystems, Foster City, CA, USA). Each genome sample was normalized to NV1 (NV1 CHO gPCR ref forward; 5′-ACAGGTTTCTGCTTCTGGCA-3′ NV1 CHO gPCR ref reverse; 5′-CATCAGCTGACTGGTTCACA-3′). NV1 was previously reported as a CHO genome reference for qPCR^{29 (link)}.

RNA isolation and reverse transcriptase (RT)-PCR was performed as described previously4 (link). miR-19b and mmu-miR-19b expression, and PITX1, hTERT, mTert mRNA expression, were detected using qRT-PCR. miR-19b expression was detected using Taq Man miR assay kits (Applied Biosystems, Assay ID: 000396, Assay Name: hsa-miR-19b) according to the manufacturer's protocol. MiR expression levels were normalized using snRNA U6 as a reference. The mRNA expression of PITX1 and hTERT was analyzed using the specific primers: PITX1: forward; 5′-GCTACCCCGACATGAGCA, reverse; 5′-GTTACGCTCGCGCTTACG), hTERT: forward; 5′- GCCTTCAAGAGCCACGTC, reverse; 5′-CCACGAACTGTCGCATGT). The mRNA expression of mTert and mmu-miR-19b was analyzed using the specific primers: mmu-miR-19b: forward; 5′- TTGCAGATTTGCAGTTCAGCGT, reverse; 5′- TCCCACAATCAGTTTTGCATGG, mTert: forward; 5′- AGAGCTTTGGGCAGAAGGA, reverse; 5′- GAGCATGCTGAAGAGAGTCTTG). cDNA was amplified using an Applied Biosystems StepOne thermal cycler system and a SYBR green PCR kit (Applied Biosystems, Foster City, CA, USA). mRNA level was normalized to human GAPDH mRNA (PCR primers: forward; 5′-AGCCACATCGCTCAGACAC, reverse; 5′-GCCCAATACGACCAAATCC) for human genes and mouse Gapdh mRNA (PCR primers: forward; 5′-TCATTGTCATACCAGGAAATGAGC, reverse; 5′-GTCTCCTGCGACTTCAACAG) for mouse genes.

RNA isolation and reverse transcriptase (RT)-PCR was performed as described previously [15 (link)]. mRNA expression of PITX1 hTERT, ZCCHC10 was analyzed using specific primers: PITX1: forward; 5'-GCTACCCCGACATGAGCA, reverse; 5'-GTTACGCTCGCGCTTACG-3’, hTERT: forward; 5'- GCCTTCAAGAGCCACGTC-3’, reverse; 5'-CCACGAACTGTCGCATGT-3’, ZCCHC10: forward; 5'-TGGACTTATGAATGCACAGGAA-3’, reverse; 5'-CTACATTGGTTTCTCCAATGCTT-3’. p21: forward; 5'-TGGAGACTCTCAGGGTCGAAA, reverse; 5'- GGCGTTTGGAGTGGTAGAAATC-3’. BAX: forward; 5'- CATCATGGGCTGGACATTG, reverse; 5'- GGGACATCAGTCGCTTCAGT-3’. BCL-2: forward; 5'- AGTACCTGAACCGGCACCT, reverse; 5'- GCCGTACAGTTCCACAAAGG-3’. cDNA was amplified using an Applied Biosystems StepOne thermal cycler system and a SYBR green PCR kit (Applied Biosystems, Foster City, CA, USA). mRNA levels were normalized against GAPDH mRNA (PCR primers: forward; 5'-AGCCACATCGCTCAGACAC, reverse; 5'-GCCCAATACGACCAAATCC).

RNA isolation and reverse transcriptase (RT)-PCR were performed as described previously^{37 (link)}. mRNA expression of SAMMSON was analyzed using specific primers: SAMMSON: forward; 5′-CCTCTAGATGTGTAAGGGTAGT, reverse; 5′-TTGAGTTGCATAGTTGAGGAA. cDNA was amplified using an Applied Biosystems StepOne thermal cycler system and SYBR green PCR kit (Foster City, CA, USA). mRNA levels were normalized against GAPDH mRNA (PCR primers: forward; 5′-AGCCACATCGCTCAGACAC, reverse; 5′-GCCCAATACGACCAAATCC).