NcoI and HindIII restriction enzymes were purchased from Thermo Scientific. Luria-Bertani (LB) broth and LB agar were purchased from BD Difco (Sparks, USA). Ni-NTA agarose was purchased from Qiagen (Hilden, Germany). Acetic acid and Amicon 0.5 mL 3k filter were purchased from Merck (Darmstadt, Germany). Dopamine hydrochloride, copper sulfate, and all other chemicals were purchased from Sigma-Aldrich Korea (Seoul, Republic of Korea). Burkholderia cepacia (ATCC 25416) was purchased from the Korean Agricultural Culture Collection (KACC, Wanju, Republic of Korea).
Hindiii restriction enzyme
Manufactured by Thermo Fisher Scientific
Sourced in United States
HindIII is a type II restriction enzyme that recognizes and cleaves the palindromic DNA sequence 5'-AAGCTT-3'. It is commonly used in molecular biology applications such as DNA digestion, cloning, and genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Proteinase k, by Thermo Fisher Scientific (2 mentions)
Copper sulfate, by Merck Group (1 mentions)
Dopamine hydrochloride, by Merck Group (1 mentions)
Acetic acid, by Merck Group (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
Facsverse flow cytometer, by BD (1 mentions)
Minibest dna fragment purification kit, by Takara Bio (1 mentions)
Rnase 1, by Merck Group (1 mentions)
Optima l 80 xp, by Beckman Coulter (1 mentions)
Ecorv, by Thermo Fisher Scientific (1 mentions)
Ecori, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Merck Group (1 mentions)
Gel extraction kit, by Thermo Fisher Scientific (1 mentions)
E coli dh5α strain, by Thermo Fisher Scientific (1 mentions)
Fast ligation kit, by Thermo Fisher Scientific (1 mentions)
Bamhi restriction enzyme, by Thermo Fisher Scientific (1 mentions)
Ecl gold hybridisation buffer, by Cytiva (1 mentions)
Ecl direct labelling and detection system kit, by Cytiva (1 mentions)
Hybond n membrane, by Cytiva (1 mentions)
8 protocols using hindiii restriction enzyme
1
Isolation and Purification of Bacterial Proteins
2
NHEJ Repair Efficiency Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NHEJ reporter assay was performed according to protocols previously reported with minor modification42 (link). Briefly, the NHEJ reporter constructs containing pPGK-GFP were digested with HindIII restriction enzymes (Thermo Scientific, #FD0504) and purified using TaKaRa MiniBEST DNA Fragment Purification kit (#9761). Then the linearized construct (1.3 μg) and the transfection control plasmids pPGK-mCherry (0.3 μg) were co-transfected into each well of cultured neurons in 12-well plates with Lipofactamine 2000 (3.2ul). Three days after transfection, cells were prepared and analyzed on FACSVerse™ Flow Cytometer (BD Biosciences) with final data analyzed by the FlowJo software. (Supplementary Fig. 12 ) The repair efficiency was represented as GFP+/mCherry+.
3
Phage DNA Extraction and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The stocks of purified phages were condensed using ultracentrifugation at 105,000 × g for 3h at 4°C (Beckman Optima L-80 XP ultracentrifuge, TYPE 45 Ti rotor). The pellet was diluted in SM buffer and treated by 10μg/ml DNase I and RNase I (Sigma, China) to digest any free DNA and RNA. The genomic DNA of phages was then extracted using phenol/chloroform/isoamyl alcohol protocol as described previously by Sambrook and Russell (2001) . Finally, the quality and quantity of the extracted DNA were examined using agarose gel electrophoresis and NanoDrop (Thermo Scientific, United States).
The digestion patterns produced by EcoRI, EcoRV, and HindIII restriction enzymes (Thermo Fisher Scientific, United States) were used for DNA fingerprinting analysis. The phage DNA and the endonuclease were mixed individually according to the manufacturer’s protocol. After the incubation period, the DNA fragments were separated by 1% agarose gel electrophoresis at 90V for 60min. The DNA libraries and whole-genome sequences were obtained using Illumina HiSeq NGS DNA sequencing system (TGS, Shenzhen, China). The raw sequencing data were assembled using SOAPdenovo (v2.04) at the default setting and the assembled sequences were deposited at DDBJ/EMBL/GenBank (Table 1 ).
The digestion patterns produced by EcoRI, EcoRV, and HindIII restriction enzymes (Thermo Fisher Scientific, United States) were used for DNA fingerprinting analysis. The phage DNA and the endonuclease were mixed individually according to the manufacturer’s protocol. After the incubation period, the DNA fragments were separated by 1% agarose gel electrophoresis at 90V for 60min. The DNA libraries and whole-genome sequences were obtained using Illumina HiSeq NGS DNA sequencing system (TGS, Shenzhen, China). The raw sequencing data were assembled using SOAPdenovo (v2.04) at the default setting and the assembled sequences were deposited at DDBJ/EMBL/GenBank (
4
Thanatin Sequence Cloning and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The thanatin sequence in plasmid vector (pGHvector+thanatin) was artificially ordered. First, pGH and pcDNA3.1+ vectors were digested separately with HindIII restriction enzymes (Thermo Fisher Scientific, USA) and then purified by gel extraction kit (Thermo Fisher Scientific, USA). Then, the purified products were again digested with BamHI restriction enzyme (Thermo Fisher Scientific, USA) and purified. The next step in constructing a recombinant plasmid was to ligate the thanatin DNA sequence into a compatibly digested vector backbone by fast ligation kit (Thermo Fisher Scientific, USA). Subsequently, the recombinant plasmid was transformed into the E. coli strain DH5α (Invitrogen, USA). In order to identify DH5α containing recombinant plasmids, the bacteria were cultured on antibiotic culture medium. Only the bacteria containing the recombinant plasmid could be colonized on the culture medium containing antibiotics. Colony PCR was performed by universal pcDNA3.1+ primers for T7 promoter (forward: TAATACGACTCACTATAGGG) and BGH (reverse: TAGAAGGCACAGTCGAGG). Afterwards, colonies were harvested and plasmid elicitation was performed by HiPure Plasmid Isolation kit (Roche, Germany). Finally, mapping and sequencing were carried out.
5
Southern Blot Hybridization of Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 1 μg of gDNA was digested with HindIII restriction enzyme (Thermo Scientific) and resolved on a 0.8% agarose gel for 1 hour at 80 V. Genomic DNA fragments were transferred from the gel to a Hybond-N + membrane (Amersham) using alkaline capillary transfer. The membrane was blocked for 1 hour at 42 °C in ECL Gold Hybridisation Buffer (Amersham) supplemented with 0.5 M of NaCl and 5% (w/v) of single strand salmon sperm DNA. Hybridisation was performed at 42 °C overnight in ECL Gold Hybridisation Buffer, hybridisation probe was labelled by ECL Direct Labelling and Detection System kit (Amersham). Washing, labelling and detection were accomplished according to the manufacturer’s directions using the ECL Direct Labelling and Detection System kit (Amersham). The probe was produced via PCR of plasmid DNA pNG-Tn-pyrF using primers pyrF-1_F and pyrF-2_R (Supplementary Table S3 ).
6
ChIP-qPCR Protocol for Lef1 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-qPCR was performed as described previously5 (link). Cells were crosslinked with formaldehyde and the reaction was quenched with glycine. Cells were lysed and chromatin was digested with HindIII restriction enzyme (Thermo Fisher FD0505). ChIP grade anti-Lef1 mouse antibody (Merck 17–604) was coupled with Dynabeads coated with sheep anti-mouse antibody (ThermoFisher 11201D). Beads were added to chromatin and bound to DNA associated Lef1. After this immunoprecipitation (IP) step, precipitated chromatin was treated with Proteinase K (Thermo Fisher 4,333,793). DNA was isolated using sodium acetate method. PCR primers were obtained either from the Epitect array (Qiagen 334,211) or as reported in the SI Appendix Table 1 .
7
Genomic DNA Extraction and Southern Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted from the leaves of 5-week-old wild-type and transgenic rice plants by using the CTAB (2% CTAB, 20 mM EDTA, 1.4 M NaCl, 2% PVP-40, and 100 mM Tris-HCl, pH 8.0) method. Total genomic DNA was digested with HindIII restriction enzyme (Thermo Scientific, United States) and separated by electrophoresis on a 0.7% agarose gel. Then, the DNA on the gel was transferred to a Hybond-N nylon membrane (GE Healthcare, United Kingdom) by the capillary transfer method, and the blot was hybridized to a 32P-labeled hygromycin B phosphotransferase (Hph) probe as described by Byun et al. (2018) (link). The autoradiography signals were visualized using a BAS2500 Bio-Imaging Analyzer (Fuji Film, Japan).
8
Comprehensive Profiling of FASRL Interactome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full‐length sense and antisense sequences of the FASRL fragment were cloned into the pcDNA3.1 vector using the HindIII restriction enzyme (Thermo Fisher Scientific, FD0504) and XhoI restriction enzyme (Thermo Fisher Scientific, FD0694). A TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific, K0441) was used to transcribe the full‐length sense and antisense RNA sequences of FASRL in vitro, and then, these sequences were purified using a GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731). A Pierce RNA 3′ End Desthiobiotinylation Kit (Thermo Fisher Scientific, 20163) was used to label the purified sense and antisense RNA sequences of FASRL with desthiobiotin at the 3′ end. Next, the lncRNA–protein complexes were purified by a Pierce Magnetic Pull‐Down Kit (Thermo Fisher Scientific, 20164) and separated by SDS‐PAGE. The separated proteins were stained with a Fast Silver Stain Kit (Beyotime, P0017S), and then, MS was performed to identify the specific proteins that bound to the FASRL. Finally, immunoblotting was used to verify that the proteins interacted with FASRL.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!