Pcdna6 myc hisb

The coding sequences for the ORF or the extracellular domain of cd58 and cd2 were amplified through RT-PCR by using primers (shown in Table S1 in Supplementary Material) containing an EcoRI site added to the 5′ end and an XhoI site added to the 3′ end. The PCR products were digested and ligated into pEGFP-N1 (Clontech) or pcDNA6/myc-His©B (Invitrogen) to construct eukaryotic expression vectors (pEGFP-cd58, pEGFP-cd2, and pcDNA6-cd58) with enhanced GFP-tag or myc-tag and into pMalc2e to construct prokaryotic expression vectors (pMalc2e-cd2) with MBP-tag (43 (link)). For eukaryotic expression of Cd58 protein, the plasmid DNA was transformed into HEK293T cells. For prokaryotic expression of Cd2 protein, the pMalc2e-cd2 was transformed into E. coli Rosetta (DE3) pLysS. Positive colonies were inoculated into Luria–Bertani medium containing kanamycin (50 µg/mL) and the protein expression was induced by isopropyl-β-d-thio-galactoside (1 mM/mL) as previously described (31 (link)). The recombinant proteins were detected via SDS-PAGE and purified through Amylose resin affinity chromatography in accordance with the manufacturer’s manual (NEB, pMAL system).

The full-length cDNA of zebrafish or human LZTFL1 was cloned into pcDNA6/myc-HisB (Invitrogen) between the BamHI and XhoI site to construct eukaryotic expression vectors named pcDNA6-Myc-ZeLZTFL1 or pcDNA6-Myc-HuLZTFL1 in which LZTFL1s were fused with Myc-tag in the C terminus.
HeLa cells (ATCC catalog number: CCL-2) and Light2 cells (ATCC catalog number: JHU-68), which were derived from NIH/3T3 cell line transfected with Gli1-responsive Firefly luciferase reporter and a constitutive Renilla-luciferase expression vector were maintained in DMEM supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL) at 37°C in 5% CO₂. HeLa cells were transfected with empty vector pcDNA6-Myc or pcDNA6-Myc-ZeLZTFL1/pcDNA6-Myc-HuLZTFL1 by Liopofectamine 2000 following the manufacturer’s protocol. At 48 h post-transfection, the transfected cells (HeLa-EV, HeLa-ZeLZTFL1, and HeLa -HuLZTFL1) were harvested for further experiment.
To elucidate zebrafish LZTFL1 roles in the hedgehog pathway, Light2 cells were co-cultured alone, with transfected cells HeLa-EV, HeLa-HuLZTFL1, or HeLa-ZeLZTFL1 for 48 h. Then, Light2 cells were lysed with Reporter Lysis Buffer (Promega) for measuring luciferase activity by using Dual-Luciferase Assay Reagent (Promega).

A complete protein coding region (CDS) of human NHE9 cDNA was cloned into pcDNA3.1 (Invitrogen) using EcoRI and Xho I sites. Subcloning was conducted into pMSCVpuro (Clontech) for stable transfection. A flag tag was added after NHE9 for immunoprecipitation assay. C-terminal of NHE9 was clone into pGEX-6p-1 (GE Healthcare), for protein prokaryotic expression and following pull-down assay. pEGFP-C2-NHE9 was constructed for fluorescein observation, using pEGFP vector (Clontech). The shRNA sequences targeted NHE9 are listed as following:, (1) GCTCTTCAGAATGTGGTAT (loop) ATACCACATTCTGAAGAGCCG; (2) ATCGTCATAGGGTTAATTA (loop) TAATTAACCCTATGACGATGC. pSUPER.retro vector (Oligoengine) was used for construction of short interfering RNA. Packaging plasmid pik (Langri biotechnology, Guangzhou) was used in virus construction. The complete CDS regime of human RACK1, GSTP1, LIGO4, PKD1 cDNA was cloned into pcDNA6/myc-HisB (Invitrogen) for co-immunoprecipitation assay.