Pcag eco

Manufactured by Addgene

The PCAG-Eco is a plasmid cloning and expression vector. It is designed for the propagation and maintenance of recombinant DNA constructs in Escherichia coli (E. coli) bacterial cells.

Automatically generated - may contain errors

Lab products found in correlation

Pcmvr8, by Addgene (3 mentions) Pumvc, by Addgene (1 mentions) Deae dextran sulfate, by Merck Group (1 mentions) Fluorescence activated cell sorting (facs), by Beckman Coulter (1 mentions) 293t cell, by American Type Culture Collection (1 mentions) Tet plko puro, by Addgene (1 mentions) Tet plko neo, by Addgene (1 mentions)

5 protocols using pcag eco

Retroviral Transduction of Rxra Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Homozygous Rxra knockout cells were transduced with empty vector (EV) or retroviral vector containing WT or S22A mutant Rxra. A CRISPR/Cas9-targeted cell clone without Rxra frameshift indels was transduced with EV and was used as control.
HEK293 FT cells were transiently transfected with pBabe Hygro Mouse Rxra, pUMVC (#8449, Addgene) [31] (link) and pCAG-Eco (#35617, Addgene) in the ratio of 8:8:1 using the TransIT-X2 Dynamic Delivery System. After incubation for 3 d, virus-containing medium was transferred to brown pre-adipocytes together with 8 μg/mL polybrene. Antibiotic selection with hygromycin (200 μg/mL) started 3 d after virus infection and until all uninfected control cells were eliminated.

Ardenkjær-Larsen J., Rupar K., Sinkevičiūtė G., Petersen P.S., Villarroel J., Lundh M., Barrès R., Rabiee A, & Emanuelli B. (2020). Insulin-induced serine 22 phosphorylation of retinoid X receptor alpha is dispensable for adipogenesis in brown adipocytes. Adipocyte, 9(1), 142-152.

+ Open protocol

+ Expand

Lentiviral Transduction of Bone Marrow-Derived Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

All lentiviral supernatants were prepared by cotransfection of HEK-293T cells with one of the vector transfer constructs, murine ecotropic envelope vector (pCAG-Eco, Addgene Plasmid # 35617), and the packaging vectors pMDLg/pRRE and RSV-Rev. For gene transduction, bone marrow-derived macrophages were used on day 5 of differentiation. Two million cells were plated in 12-well plates, and viruses (MOI = 20) were added to each well in the presence of 6 μg/ml of DEAE-dextran sulfate (Sigma-Aldrich, St. Louis, MO).

Kim H.S., Tavakoli S., Piefer L.A., Nguyen H.N, & Asmis R. (2016). Monocytic MKP-1 is a Sensor of the Metabolic Environment and Regulates Function and Phenotypic Fate of Monocyte-Derived Macrophages in Atherosclerosis. Scientific Reports, 6, 34223.

+ Open protocol

+ Expand

Establishment of Pax2-overexpressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The construction of the RM-PAX2 and RM-pWPI cell lines has been described in detail previously (5 (link)). Briefly, the murine Pax2 cDNA (pax2-b variant) was cloned from murine oviduct and inserted into the Not I site of pWPI (Addgene plasmid 12254) to generate a lentivirus expression vector (WPI-Pax2-IRES-eGFP, hereafter pWPI-Pax2). The empty pWPI vector was used as a control. The vector plasmids (pWPI or pWPI-Pax2), packaging plasmid pCMVR8.74 (Addgene plasmid 22036), and the ecotropic envelope expression plasmid, pCAG-Eco (Addgene plasmid 35617) were co-transfected into 293T cells (ATCC^® CRL-3216™) to generate lentivirus. RM cells were infected with lentivirus and then passaged at least 3 times prior to sorting for GFP expression by fluorescence-activated cell sorting (Beckman Coulter, Inc.).

Feng Y., Tang Y., Mao Y., Liu Y., Yao D., Yang L., Garson K., Vanderhyden B.C, & Wang Q. (2020). PAX2 promotes epithelial ovarian cancer progression involving fatty acid metabolic reprogramming. International Journal of Oncology, 56(3), 697-708.

+ Open protocol

+ Expand

Lentiviral Vectors for Pax2 Expression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

The murine Pax2 cDNA, corresponding to pax2-b variant, was cloned from the murine oviduct and inserted into pWPI (Addgene plasmid #12254) to generate the lentivirus expression vector (WPI-Pax2-IRES-eGFP), as described previously [48 ]. For shRNA mediated knockdown, lentiviral vectors Tet-pLKO-neo and Tet-pLKO-puro were used to generate PAX2 specific knockdown vectors pLKO-17 (CCCAAAGTGGTGGACAAGATT) and pLKO19 (CAGGCATCAGAGCACATCAAA), respectively. Pax2 target sequences for each vector are indicated in brackets. Tet-pLKO-neo (Addgene plasmid 21916) and Tet-pLKO-puro (Addgene plasmid 21915) were gifts from Dmitri Wiederschain [51 (link)]. Lentiviral vectors were prepared by co-transfection of vector plasmids, with packaging plasmid pCMVR8.74 (Addgene plasmid #22036) and the ecotropic envelope expression plasmid, pCAG-Eco (Addgene plasmid 35617) into 293T cells as described previously [52 (link)]. Plasmids pWPI and pCMVR8.74 were gifts from Didier Trono and plasmid pCAG-Eco was a gift from Arthur Nienhuis and Patrick Salmon.

Alwosaibai K., Abedini A., Al-Hujaily E.M., Tang Y., Garson K., Collins O, & Vanderhyden B.C. (2017). PAX2 maintains the differentiation of mouse oviductal epithelium and inhibits the transition to a stem cell-like state. Oncotarget, 8(44), 76881-76897.

+ Open protocol

+ Expand

Lentiviral Vector for Pax2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The murine Pax2 cDNA, corresponding to the pax2-b variant, was cloned from the murine oviduct and inserted into pWPI (Addgene plasmid #12254) to generate the lentivirus expression vector (WPI-Pax2-IRES-eGFP) as described previously (25) .
Lentiviral vectors were prepared by co-transfection of vector plasmids with packaging plasmid pCMVR8.74 (Addgene plasmid #22036) and the ecotropic envelope expression plasmid, pCAG-Eco (Addgene plasmid 35617) into 293T cells as described previously (26) . Plasmids pWPI and pCMVR8.74 were gifts from Didier Trono and plasmid pCAG-Eco was a gift from Arthur Nienhuis and Patrick Salmon.

Alwosaibai K., Al-Hujaily E.M., Alamri S., Garson K., & Vanderhyden B.C. (2020). PAX2 Induces Tubular-Like Structures in Normal and Ovarian Cancer Cells.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!