Amv 2 reverse transcription system

Manufactured by Promega

Sourced in United States

The AMV II Reverse Transcription System is a laboratory instrument designed for the conversion of RNA to complementary DNA (cDNA). It utilizes the AMV (Avian Myeloblastosis Virus) reverse transcriptase enzyme to facilitate this process.

Automatically generated - may contain errors

Lab products found in correlation

Emeraldamp gt pcr kit, by Takara Bio (4 mentions) T100 thermal cycler, by Bio-Rad (2 mentions) Zr rna miniprep kit, by Zymo Research (2 mentions) Chemidoc xrs image analyser, by Bio-Rad (1 mentions) Emeraldamp gt pcr master mix, by Takara Bio (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) D digit gel scanner, by LI COR (1 mentions) Novel juice, by GeneDireX (1 mentions) Muse annexin 5 and dead cell assay, by Merck Group (1 mentions) Muse cell cycle assay, by Merck Group (1 mentions) Muse count and viability assay, by Merck Group (1 mentions) Muse mapk assay, by Merck Group (1 mentions) Muse mitopotential assay, by Merck Group (1 mentions) Dimethyl sulfoxide (dmso), by Merck Group (1 mentions)

Spelling variants of this product

Reverse Transcription System (942 citations) AMV reverse transcription system (38 citations) Reverse Transcription II system (4 citations)

4 protocols using amv 2 reverse transcription system

Profiling Survivin Splice Variants in MCF-7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from treated and untreated MCF-7 cells using TRIzol reagent from ThermoFisher Scientific, USA. Complementary deoxyribonucleic acid (cDNA) was synthesized from the total RNA using the AMV II Reverse transcription System (Promega, USA). The cDNA samples were normalized to a consistent concentration of 200 ng. The cDNA samples were then subjected to PCR using primers which amplify the different survivin splice variants (Table 1).
The EmeraldAmp^® GT PCR Kit (Takara Bio, USA) was used and the manufacturer’s instructions were followed. Briefly, the 25 µL reaction mix containing 12.5 µL EmeraldAmp^®, GT PCR Master Mix (Takara Bio), 1 µl of each primer, 9.5 µl of water and 1 µl of DNA template. The PCR products were visualised on a 1.3% agarose gels. The gels were then viewed using a Chemidoc XRS image analyser (BioRad, Hercules, CA, USA).

Laka K., Makgoo L, & Mbita Z. (2019). Survivin Splice Variants in Arsenic Trioxide (As2O3)-Induced Deactivation of PI3K and MAPK Cell Signalling Pathways in MCF-7 Cells. Genes, 10(1), 41.

+ Open protocol

+ Expand

Analysis of Apoptosis and Cell Cycle Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

ZR^® RNA MiniPrep Kit (Zymo Research, United States) was used for total RNA extraction and manufacturer’s instructions were followed. The complementary deoxyribonucleic acid (cDNA) was synthesised using a Promega AMV II Reverse Transcription System (United States). The EmeraldAmp^® GT PCR Kit (Takara Bio, United States) was employed for the amplification of apoptosis-related genes, cell cycle-related genes and STAT genes using the primer sets (Table 1). Amplification was done using T100^™ Thermal Cycler (BioRad, United States). The PCR products were mixed with the novel juice (Genedirex, Taiwan). Samples were visualised using 2% agarose gels, which were viewed using D-DiGit Gel Scanner (LICOR, United States). The band densities from three independent experiments were measured and analysed using ImageJ software [National Institutes of Health (NIH), United States].

Laka K, & Mbita Z. (2022). P53-Related Anticancer Activities of Drimia calcarata Bulb Extracts Against Lung Cancer. Frontiers in Molecular Biosciences, 9, 876213.

+ Open protocol

+ Expand

Quantitative Expression Analysis of Apoptosis and STAT Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

ZR® RNA MiniPrep Kit (Zymo Research, USA) was used for total RNA was extracted, and manufacturer’s instructions were followed. The complementary deoxyribonucleic acid (cDNA) was synthesised using Promega AMV II Reverse Transcription System (USA). The EmeraldAmp® GT PCR Kit (Takara Bio, USA) was employed for the amplification of apoptosis-related genes and STAT genes. Amplification using different primer sets shown in Table 1 was done using T100™ Thermal Cycler (BioRad, USA).. The PCR products were mixed with the novel juice (Cat no. LD001-1000) [Celtic Molecular Diagnostic, South Africa]. Samples were visualised using 2 % agarose gels which were viewed using D-DiGit Gel Scanner (Analytical technology, South Africa). The band densities from three independent experiments were measure using Image J software.Table 1

The primer sequences of apoptosis-related genes and STAT genes.

Table 1

Gene	Forward Primers	Reverse Primer
p53	5′- GTTGCCCAGGCTGGAGTGGAG -3′	5′- GGCTGAGACAGGTGGATCGC -3′
Bcl-2	5′- GCACCGGGCATCTTCTCCTC-3′	5′- CCGAGATGTCCAGCCAGCTG -3′
Bax	5′-GGGTGGTTGGGTGAGACTC-3′	5′-AGACACGTAAGGAAACGCATTA-3′
STAT1	5′-GCCCCGATGGTCTCATTCCG-3′	5′-GTCCTTCAACAGGGCACGCT-3′
STAT3	5′-TGCCTGCGGCATCCTTCTGC-3′	5′-ACAGGCGTGAGCCACCATGC-3′
STAT5B	5′-GGATGGGTGCATCGGGGAAG-3′	5′-TCTCAGAGGCAGGTGCTGGT-3′
GAPDH	AGCTGAACGGGAAGCTCACT	TGCTGTAGCCAAATTCGTTG

Laka K., Mapheto K.B, & Mbita Z. (2021). Selective in vitro cytotoxicity effect of Drimia calcarata bulb extracts against p53 mutant HT-29 and p53 wild-type Caco-2 colorectal cancer cells through STAT5B regulation. Toxicology Reports, 8, 1265-1279.

+ Open protocol

+ Expand

MCF-7 Cell Culture and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MCF-7 cells were kindly donated by Prof Mervin Meyer from the University of the Western Cape, South Africa. Dulbecco’s Modified Eagle Medium (DMEM) and foetal bovine serum (FBS) were purchased from Hyclone (Hyclone, South Logan, UT, USA). Antibiotic mixture containing penicillin and streptomycin (Pen-Strep), phosphate buffered saline (PBS) the MTT [3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide], 4′, 6-diamidino-2-phenylindole (DAPI), Trizol reagent were obtained from ThermoFisher Scientific (ThermoFischer Scientific, Waltham, MA, USA) while Dimethyl Sulfoxide (DMSO) was purchased from (Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO, USA). The AMV II Reverse transcription system was purchased from Promega (Promega, Madison, WI, USA) while the EmeraldAmp^® GT-PCR Kit was procured from Takara Bio (Takara Bio, Kasatsu, Shiga Prefecture, Japan). The Muse^® Assay Kits (Muse^® Count and Viability Assay, Muse^® Cell Cycle Assay, Muse^® Annexin V and Dead Cell Assay, Muse^® MitoPotential Assay, Muse^® Multi-Caspase Assay, Muse^® MAPK Assay and Muse^® PI3k Assay) were all purchased from Merck-Millipore (Merck-Millipore, Darmstadt, Germany). All the reagents were used without further purification or alterations.

Laka K., Makgoo L, & Mbita Z. (2019). Survivin Splice Variants in Arsenic Trioxide (As2O3)-Induced Deactivation of PI3K and MAPK Cell Signalling Pathways in MCF-7 Cells. Genes, 10(1), 41.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!