Mouse anti calreticulin

Digitonin was obtained from Merck (Darmstadt, Germany), lactacystin was purchased from Enzo Life Sciences (Farmingdale, NY, USA), and epoxomicin was purchased from UBPBio (Oxfordshire, UK). The mouse monoclonal anti-HA antibodies, anti-rabbit Alexa594 and anti-mouse Alexa488 were obtained from Thermo Fisher Scientific (Waltham, MA, USA). The mouse monoclonal anti-EDEM1, monoclonal anti-β-actin-peroxidase, rabbit anti-APP C-terminal, as well as the secondary anti-rabbit HRP and anti-mouse HRP antibodies were from Merck (Darmstadt, Germany). The mouse monoclonal anti-APP were obtained from OriGene (Rockville, MD, USA), the rabbit anti-PDI were from Cell Signaling (Danvers, MA, USA). The mouse anti-calreticulin was from Enzo Life Sciences (Farmingdale, NY, USA), whereas mouse monoclonal anti-calnexin was from BD Biosciences (Bedford, MA, USA). The mouse anti-HSP70 was obtained from Santa Cruz Biotechnology (Dallas, TX, USA).

The following reagents were used: rabbit anti-AXIN1 (C95H11), rabbit anti-AXIN2 (76G6) (Cell Signaling Technology), mouse anti-β-catenin (BD Transduction Laboratories); mouse anti-ubiquitin (Upstate / Millipore), mouse anti-active-β-catenin (05–665, Millipore); mouse anti-β-Actin (Sigma Aldrich), mouse anti-Calreticulin (Enzo lifesciences), mouse anti-Vinculin (HVIN-1, Sigma Aldrich), rabbit anti-FoxM1 (C-20, Santa Cruz), mouse anti-LaminA (Abcam), rabbit anti-p62 (MBL / Nordic Biosite). All secondary antibodies used for confocal microscopy studies were obtained from Jacksons ImmunoResearch Laboratories and secondary antibodies used for Western blotting were obtained from LI-COR Biosciences GmbH. Hoechst (Invitrogen). G007-LK (Gift from Stefan Krauss and Jo Waaler, Oslo, Norway); MG132 (Calbiochem); Dimethyl sulphoxide (DMSO), 3-Methyladenine (3-MA), Lactacystin, PhosSTOP (Sigma Aldrich); Epoximicin (Enzo lifesciences); Leupeptin (Peptanova Gmbh, Peptide Insitute, Japan). Quantitech mRNA primer pairs against TBP (QT00000721), AXIN2 (QT00037639) and FoxM1 (QT00000140) were obtained from Qiagen. FoxM1 siRNA (Sense: 5' GGACCACUUUCCCUACUUUUU-3', Antisense: 5' AAAGUAGGGAAAGUGGUCCUU 3' [21 (link)], and control siRNA (cat: D-001810-01), Dharmacon. siRNA transfections were performed using RNAiMax (Invitrogen) according to the manufacturer's protocol.