Qpcr instrument

Manufactured by Thermo Fisher Scientific

Sourced in Canada

The QPCR instrument is a laboratory equipment used for real-time quantitative polymerase chain reaction (qPCR) analysis. The core function of the QPCR instrument is to accurately measure and quantify the amplification of target DNA sequences in a sample during the PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

StepOne Plus qPCR instrument (26 citations) QuantStudio 3 qPCR instrument (4 citations) SYBR GreenER™ qPCR SuperMix for ABI PRISM™ Instrument (4 citations) ABI 7500 fluorescence qPCR instrument (4 citations) StepOne Plus Real Time QPCR instrument (2 citations) CFX96 qPCR instrument (2 citations) SYBR GreenER qPCR SuperMix for iCycler Instrument (2 citations) 7500 Fast qPCR instrument (2 citations) ABI StepOne Plus qPCR instrument (2 citations) AB ViiA7 RT-qPCR instrument (2 citations)

10 protocols using qpcr instrument

Measuring HIF1A and miR-199a Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA for HIF1A was extracted with TRIzol reagent kit (Ambion, USA) and the
total RNA for miR-199a was extracted using a mirVana microRNA Isolation Kit
(Ambion) according to the manufacturer’s protocol. After added poly(A) tail on
miRNA, the complementary DNAs (cDNAs) were acquired based on
oligo(dT)₁₈ primers and Moloney Murine Leukemia Virus (M-MLV)
reverse transcriptase utilizing SYBR Green Master Mix kit (Applied Biosystems).
qRT-PCR assay was conducted with quantitative polymerase chain reaction (qPCR)
instrument (Fermentas, Burlington, ON, Canada) to detect relative expression
levels of miR-199a and HIF1A mRNA. HIF1A gene was amplified using specific
oligonucleotide primer and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or
U6 was used as an endogenous control. The PCR primer sequences of HIF1A gene
were as follows: 5′-GAACGTCGAAAAGAAAAGTCTCG-3′ and
5′-CCTTATCAAGATGCGAACTCACA-3′; GAPDH, 5′-CAACGAATT TG GCTACAGC A-3′ and
5′-AGGGGTCTACATGGCAACTG-3′. miR-199a, 5′-CAATCGCTTTCAAATAG-3′ and
5′-CAGGAGATGCTGTC ATC-3′. U6, 5′-CTCGCTTCGGCAGCACA-3′ and 5′-AACGCTTCACGAATT
TGCGT-3′. For the detection of miRNA, miRNA-specific looped RT-primers and
TaqMan probes were used as described by the manufacturer’s protocol (Applied
Biosystems). PCRs were performed in triplicate using a 7300 Real-Time PCR system
(Applied Biosystems), and the data were analyzed using the comparative Ct method
(2^-∆∆Ct).

Wang Y., Dai Y.X., Wang S.Q., Qiu M.K., Quan Z.W., Liu Y.B, & Ou J.M. (2017). miR-199a-5p inhibits proliferation and induces apoptosis in hemangioma cells through targeting HIF1A. International Journal of Immunopathology and Pharmacology, 31, 0394632017749357.

+ Open protocol

+ Expand

Quantitative miRNA and mRNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction was conducted with aid of Trizol reagent kit (Ambion, USA) in line with the manufacturers’ descriptions. After added poly(A) tail on miRNA, the cDNAs were acquired based on oligo(dT)₁₈ primers and M-MLV reverse transcriptase utilizing the reverse transcription Kit (Fermentas, Canada). RT-qPCR assay was conducted with qPCR instrument (Fermentas, Canada) to detect relative expression levels of miR-199a-3p and Smad1 mRNA. The primers synthesized by Invitrogen were displayed in Table 1. The reaction conditions were set as follows: 1) pre-degeneration at 95°C for 10 minutes, 2) degeneration at 95°C for 10 seconds, and 3) annealing at 60°C for 20 seconds and extension at 72°C for 35 seconds. The relative expression quantity was calculated using the 2^−△△Ct method. The experiment was replicated for three times.

Qu F., Zheng J., Gan W., Lian H., He H., Li W., Yuan T., Yang Y., Li X., Ji C., Yan X., Xu L, & Guo H. (2017). MiR-199a-3p suppresses proliferation and invasion of prostate cancer cells by targeting Smad1. Oncotarget, 8(32), 52465-52473.

+ Open protocol

+ Expand

Methylation Analysis of PRKY Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples were obtained from patients before prostate biopsy or PVP and centrifuged within 4 h after collection (centrifugal radius, 9 cm; centrifugal speed, 63.5 r/minutes; centrifugal force, 4000 g; centrifugal time, 10 min; the centrifuge was from Eppendor, Germany). Bisulfite sequencing polymerase chain reaction (BSP) was used for methylation sequencing. Two sites of PRKY promoter, cg05618150 and cg05163709, were detected by designed DNA probes (Zhengze, China) after bisulfite conversion. The β-actin sequence was selected as the control. The premixed solution was made according to Table 1. Briefly, 15 µl of solution and 10 µl of template were mixed in each well of 96-well plates and prepared for quantitative real-time polymerase chain reaction (qPCR). The qPCR instrument (Thermo Fisher, America) was set as follows: 95 °C for 5 s for initial denaturation; 95 °C for 15 s for denaturation; and 56 °C for 1 min for annealing, extension and fluorescent detection. The cycle threshold (Ct) was recorded for analysis.Table 1

Elements of the premixed solution in qPCR

Name	Volume (uL)	Name	Volume (Ul)
qPCR mix	12.5	qPCR mix	12.5
Ppmix	2.5	F-cg05163709	0.3
		R-cg05163709	0.3
		P-cg05163709	0.2
		F-cg05618150	0.3
		R-cg05618150	0.3
		P-cg05618150	0.2
		F-ACTB	0.25
		R-ACTB	0.25
		P-ACTB	0.15
		ddH2O	0.25
total	15	total	15

Wang Y., Liu W., Chen Z., Zang Y., Xu L., Dai Z., Zhou Y, & Zhu J. (2024). A noninvasive method for predicting clinically significant prostate cancer using magnetic resonance imaging combined with PRKY promoter methylation level: a machine learning study. BMC Medical Imaging, 24, 60.

+ Open protocol

+ Expand

Quantitative Analysis of Inflammatory Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from BV2 cells and dissolved with RNase-free H₂O. One microliter of this RNA solution from each group was used to detect the RNA concentration using a microdetector. An A260/A280 ratio of 1.8–2.0 was considered optimal. Quantitative real-time polymerase chain reaction (Q-PCR) analyses were performed in a Q-PCR instrument (Thermo Fisher Scientific, USA) with the SYBR Green PCR master mix reagent (Thermo Fisher Scientific, USA) in 40 cycles. The denaturing, annealing, and extension conditions of each PCR cycle were 94℃ for 5s, 94℃ for 30s, 56℃ for 30s, and 72℃ for 30s. The relative amount or fold change of the target gene expression was normalized relative to the level of GAPDH and relative to a control. The primer sequences for Q-PCR are shown in Table 1.Table 1

Primer Sequence

Gene		Sequence (5´-3´)
IL-18	Forward	FACCAAGTTCTCTTCGTTGAC
IL-18	Reverse	RCTTCACAGAGAGGGTCACAG
IL-1β	Forward	GCCCATCCTCTGTGACTCAT
IL-1β	Reverse	AGGCCACAGGTATTTTGTCG
TNF-α	Forward	CGTCAGCCGATTTGCTATCT
TNF-α	Reverse	CGGACTCCGCAAAGTCTAAG
GAPDH	Forward	GCACCGTCAAGGCTGAGAAC
GAPDH	Reverse	TGGTGAAGACGCCAGTGGA

Hou S., Li C., Wang Y., Sun J., Guo Y., Ning X., Ma K., Li X., Shao H., Cui G., Jin M, & Du Z. (2022). Silica Nanoparticles Cause Activation of NLRP3 Inflammasome in-vitro Model-Using Microglia. International Journal of Nanomedicine, 17, 5247-5264.

+ Open protocol

+ Expand

CRISPR/Cas12a Fluorescence and Lateral Flow Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

The detection system of CRISPR/Cas12a fluorescence system includes nucleic free water 10.5 μL, RNase inhibitor (1U/ μ L), 2 μ L 10 × NEBuffer 2.1 × 2 μ L LbCas12a (1 μ M), 2 μ L crRNA (2 μ M), 0.5 μ L fluorescence labeled ssDNA signal probe (10 μ M). Finally, 2 μ L of RPA amplification products were added and mixed evenly and centrifuged for 3 s and incubated at 37 °C in a qPCR instrument (Thermo Fischer), the HEX fluorescence channel was used to record the fluorescence signal intensity of the samples every 1 min (record 60 min continuously).
As to the lateral flow detection assay, the operating procedure was concordant with the steps mentioned above, except that the fluorescence labeled ssDNA signal probe was replaced by lateral flow ssDNA signal probe that is labeled on opposing ends with FAM and biotin. The final RPA and CRISPR/Cas12a mixture were incubated at 37 °C and then the reaction mixture was diluted 5 times with ddH₂O. The lateral flow strips were inserted into the solution for 3 min and taken out for observation or photograph.

Huang S., Wang X., Chen X., Liu X., Xu Q., Zhang L., Huang G, & Wu J. (2023). Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection. Scientific Reports, 13, 19199.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis in KG1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sorted CD34⁺CD38⁻ KG1 cells were grouped and treated using the protocols as described previously. Total RNA was isolated using the RNA isolation kit (Kangwei Shiji, Biotechnology Co., Ltd., Beijing, China), and cDNA was prepared using the SuperRT cDNA Synthesis kit (Kangwei Shiji, Biotechnology Co., Ltd.). The following primers (Sangon Biotechnology, Shanghai, China) were used: β-actin forward, 5′-CCAAGGCCAACCGCGAGAAGATGAC-3′ and reverse, 5′-AGGGTACATGGTGGTGCCGCCAGAC-3′; PTEN forward, 5′-ACCAGGACCAGAGGAAACCT-3′ and reverse, 5′-GCTAGCCTCTGGATTTGACG-3′; Topo IIα forward, 5′-GTGCGTGAAGTTGTGAATA-3′ and reverse, 5′-GAGAGACACCAGAATTCAA-3′; mTOR forward, 5′-TAACGAGCTGGTCCGAATCA-3′ and reverse, 5′-AGGGTGGACTTAGCTGGACT-3′. RT-qPCR was performed on the qPCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the SYBR-Green PCR kit (Beijing BioTake Biotechnology, Beijing, China). The optimized parameters for PCR were: 95°C for 2 min, 95°C for 15 sec, 60°C for 30 sec and 72°C for 40 sec (40 cycles). The mean relative expression of PTEN, TopoII and mTOR in triplicate samples was calculated according to the 2^−ΔΔCq method (9 (link)).

Shi Z.X., Li H.Y., Yang X.D., Gao H., Li D.G., Yang W.H., Yao F, & Yan L.X. (2017). Yi-qi-yang-yin-tang increases the sensitivity of KG1a leukemia stem cells to daunorubicin by promoting cell cycle progression and regulating the expression of PTEN, TOPOII and mTOR. Oncology Letters, 14(6), 6441-6448.

+ Open protocol

+ Expand

Quantitative Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Yeast cultures were grown to exponential phase (OD600 = 1) and 50 OD600 units of cells were collected. Cells were lysed by the hot phenol method, RNA was purified on-column using RNeasy Mini Kit (Qiagen), treated with Turbo DNase (ThermoFischer) and cleaned up by a second RNeasy Mini Kit purification. 500 ng of pure RNA was reverse transcribed (Superscript III kit, Invitrogen) using the primers indicated in Supplementary file 2 and quantified by qPCR on Applied Biosystems qPCR instrument. act1⁺ was used as an internal control. Statistical analysis was performed on three biological replicates.

Shipkovenska G., Durango A., Kalocsay M., Gygi S.P, & Moazed D. (2020). A conserved RNA degradation complex required for spreading and epigenetic inheritance of heterochromatin. eLife, 9, e54341.

+ Open protocol

+ Expand

Transcriptional Profiling of Worm Stress

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression analysis was performed as previously described^{59 (link)}. Briefly, synchronized samples containing approximately 1000 worms per sample were all collected after 72 h of PD versus NL exposure from hatch. RNA was extracted using the freeze crack method and trizol/chloroform before being further purified using the RNeasy mini kit (Qiagen, Valencia, CA, USA). cDNA was synthesized from 1 µg of RNA using the QuantiTect kit (Qiagen). In all, n = 3–6 biological repeats were analyzed in triplicates (technical repeats) using SYBR green, an Applied Biosystems QPCR instrument, and the standard curve method. Expression was normalized using the geometric mean of the three housekeeping genes: cdc-42, pmp-3, and Y45F10.D4^{60 (link)}. The Roche Universal ProbeFinder online tool was used to design primers. Primers used to detect each transcript are detailed in Supplementary Table 3.

De Magalhaes Filho C.D., Henriquez B., Seah N.E., Evans R.M., Lapierre L.R, & Dillin A. (2018). Visible light reduces C. elegans longevity. Nature Communications, 9, 927.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HeLa and MEF cells (control, KD or KO, as indicated) using the RNeasy kit from QIAGEN, according to the manufacturer’s protocol. Single stranded cDNA synthesis was performed using the QuantiTect Reverse Transcription Kit (QIAGEN) following manufacturer’s instructions.
For the analysis of KD levels by RT-qPCR, the Taqman chemistry (Thermo Fisher Scientific) was used; qPCR instrument was from Applied Biosystems. For the different genes, inventoried Taqman assays (Applied Biosystems) were employed, indicated in the Key Resources Table.
For the transcriptomics analysis of EGF-induced genes (Figures 7A and 7B), total RNA was reverse-transcribed with SuperScript® VILO cDNA Synthesis Kit (Life Technologies cat.no. 11754050) and measured with Quantifast SYBR green master mix (QIAGEN) in Biorad Cfx384 RT-qPCR detection system. The complete list of primers used in this study is shown in Table S1.

Pascolutti R., Algisi V., Conte A., Raimondi A., Pasham M., Upadhyayula S., Gaudin R., Maritzen T., Barbieri E., Caldieri G., Tordonato C., Confalonieri S., Freddi S., Malabarba M.G., Maspero E., Polo S., Tacchetti C., Haucke V., Kirchhausen T., Di Fiore P.P, & Sigismund S. (2019). Molecularly Distinct Clathrin-Coated Pits Differentially Impact EGFR Fate and Signaling. Cell Reports, 27(10), 3049-3061.e6.

+ Open protocol

+ Expand

Measurement of Osteogenic Potential

Check if the same lab product or an alternative is used in the 5 most similar protocols

The instruments used in the study were Piezosurgery (Exploiter TM UOSS-II; Beijing Boda Hi-Tech Co., Ltd., Beijing, China), thermometer (Shanghai Medical University Instrument Factory, Shanghai, China), turbine mixer (Shanghai Medical University Instrument Factory), water bath (Shanghai Pudong Physical Optical Instrument Factory, Shanghai, China), refrigerator (Haier Co., Ltd., Qingdao, China), inverted microscope (Olympus Corp., Tokyo, Japan), and qPCR instrument (Applied Biosystems Life Technologies, Foster City, CA, USA).

Han J, & He H. (2016). Effects of piezosurgery in accelerating the movement of orthodontic alveolar bone tooth of rats and the expression mechanism of BMP-2. Experimental and Therapeutic Medicine, 12(5), 3009-3013.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!