Human u937 monocytic cells

Human U937 monocytic cells (ATCC, Rockville, MD) were cultured in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum (FBS), 2 mM glutamine and 100 U/ml of penicillin and streptomycin at 37°C and 5% CO₂. For preparation of cytosolic extracts, cells were treated under either normoxic (21% O₂) or hypoxic (1% O₂) conditions for 8, 24 or 48 h. Cell lysates were prepared in Phosphosafe extraction buffer containing protease inhibitor cocktail. To silence endogenous genes, U937 cells (5 × 10⁶ cells) were transfected with gene-specific siRNA or a scrambled control siRNA (100–200 nM) using human monocyte Nucleofector Kit (Lonza). To determine miRNA function, U937 cells (5 × 10⁶ cells) were transfected with oligomers including pre-miR miRNA precursor mimics, miRNA-negative control, anti-miR inhibitors, anti-miR-negative control (50–200 nM, Ambion) and plasmid DNA (0.5–2.0 μg) using the Nucleofector Kit. Relatively high levels of miR mimics and anti-miR inhibitors are used due to the low transfection efficiency of U937 cells and the need to achieve high miRNA levels to be effective decoys. The sequences of anti-miR-574-3p inhibitor: 5΄ ugugggugugugcaugagcgug 3΄.