Total RNA from cell cultures was extracted using the semi-automated Maxwell RSC simplyRNA tissue kit (Promega) or from frozen mouse crural muscles (soleus and gastrocnemius) with TRIzol Reagent (Thermo Fisher). Prior to RNA isolation, EVs underwent pre-treatment with proteinase/RNase to eliminate co-precipitated free RNA. Then, total RNA was extracted using Direct-Zol RNA Miniprep kit (Zymo Research) following the manufacturer instructions. 1 μg of total RNA was reverse transcribed with random primers and Moloney murine leukemia virus reverse transcriptase (Thermo Fisher Scientific). For miRNAs, 5 ng of total RNA was retro-transcribed with stem-loop reverse transcription primers (Thermo Fisher Scientific) and MultiScribe reverse transcriptase enzyme (Thermo Fisher Scientific). qPCRs were performed on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) using PrimeTime qPCR gene expression assays (IDT) for the protein-coding transcripts and TaqMan® MicroRNA Assays (Thermo Fisher Scientific) for the miRNAs (Supplemental Table 1). β-actin and GAPDH were used as housekeeping genes for mRNA analysis in mouse and human samples respectively. RNU6-1 (codifying for U6 snRNA) was used as reference gene to normalize miRNA readouts for mouse samples, and miR-103a for human samples.
Multiscribe reverse transcriptase enzyme
Manufactured by Thermo Fisher Scientific
Sourced in United States
MultiScribe Reverse Transcriptase is an enzyme used in the process of converting RNA into complementary DNA (cDNA). Its core function is to catalyze the synthesis of single-stranded cDNA from an RNA template.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Qiashredder kit, by Qiagen (3 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
7300 real time pcr rt pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Abi 7700 sequence detector system, by Thermo Fisher Scientific (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Maxwell rsc simplyrna tissue kit, by Promega (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Stem loop reverse transcription primers, by Thermo Fisher Scientific (1 mentions)
Direct zol rna miniprep kit, by Zymo Research (1 mentions)
Quantstudio 3, by Thermo Fisher Scientific (1 mentions)
Thermal cycler, by Thermo Fisher Scientific (1 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
17 protocols using multiscribe reverse transcriptase enzyme
1
Extraction and Analysis of RNA from Cells and Tissues
2
Investigating Apoptosis-Related Genes by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to choose genes related to cell death processes and which were regulated by miRNAs previously associated with the ML and DL forms in the study, we consulted the notes deposited in the TargetScan database. TaqMan™ assays containing specific primers and probes for the BCL2 (Hs01048932_g1), CFLAR (Hs01048932_g1), ATG12, (Hs00269492_m1), GZMB (Hs00188051_m1), and TNFRSF10A (Hs00269492_m1) genes were purchased from Thermo Fisher Scientific as well as the normalizer for the ACTB gene (Hs99999903_m1). Reverse transcription reactions were performed using the commercially available High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific), starting from 10µl of total RNA and using the MultiScribe Reverse Transcriptase enzyme, according to the manufacturer’s instructions. Gene expression analysis was performed using the qPCR technique with the QuantStudio 3 (Applied Biosystems®). All samples were prepared in duplicate using the reagents recommended by the manufacturer. Data were analyzed using the Ct comparative method, according to the 2-ΔΔ CT equation, where Δ CT is the Ct value of the target gene subtracted from the Ct of the endogenous gene, and the ΔΔCT is the ΔCT value of each individual, minus the median ΔCT of the control group.
3
Quantifying mRNA Levels via Reverse Transcription and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA quantification, cDNA was synthesized using a high capacity reverse transcription kit (Applied Biosystems, Foster City, CA, USA) a 20-µL reaction was prepared as follows: 2 µL of 10× RT buffer, 0.8 µL of 25× dNTPs 100 mM, 2 µL of 10× random primers, 1 µL of Multiscribe reverse transcriptase enzyme (50 U/µL), 1 µL of RNase inhibitor, 13.2 µL of nuclease free water containing the extracted RNA.
The reactions were then incubated in a thermal cycler (Thermo Fisher Scientific, Waltham, MA, USA) at 25℃ for 10 mins, 37℃ for 120 min, 85℃ for 5 min, and then held at 4℃. Real-time PCR was performed on a DNA Technology DTprime4 instrument (Prix Galien, Russia) using TaqMan gene expression assays for BCR-ABL. A 20-µL reaction was prepared as follows: 10 µL of ABI 2× universal PCR master mix, 1 µL of forward primer, and 9 µL of diluted cDNA were added. The PCR volumes were then loaded into the PCR machine and incubated at 95℃ for 10 min, followed by 40 cycles of 95℃ for 10 sec and 60℃ for 30 sec.
The reactions were then incubated in a thermal cycler (Thermo Fisher Scientific, Waltham, MA, USA) at 25℃ for 10 mins, 37℃ for 120 min, 85℃ for 5 min, and then held at 4℃. Real-time PCR was performed on a DNA Technology DTprime4 instrument (Prix Galien, Russia) using TaqMan gene expression assays for BCR-ABL. A 20-µL reaction was prepared as follows: 10 µL of ABI 2× universal PCR master mix, 1 µL of forward primer, and 9 µL of diluted cDNA were added. The PCR volumes were then loaded into the PCR machine and incubated at 95℃ for 10 min, followed by 40 cycles of 95℃ for 10 sec and 60℃ for 30 sec.
4
Total RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples were homogenized in Trizol reagent (Invitrogen) for total RNA extraction. Reverse transcription reaction was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using 1 μg of total RNA after RNase-free DNase I (Invitrogen) treatment, Multiscribe Reverse Transcriptase enzyme (2.5 U/μL) and random primers for 10 min at 25°C followed by 2 hours of incubation at 37°C. As a control for the DNAse treatment efficiency, we performed control reactions without the enzyme followed by testing the capacity of amplification by PCR.
5
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples were homogenized in Trizol reagent (Invitrogen) for total RNA extraction. Reverse transcription reaction was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using 1°g of total RNA (after RNase-free DNase I (Invitrogen) treatment and checking RNA integrity in 2% agarose gels), Multiscribe Reverse Transcriptase enzyme (2.5 U/°L) and random primers for 10 min at 25°C followed by 2 hours of incubation at 37°C. As a control for the DNAse treatment efficiency, we performed control reactions without the enzyme followed by testing the capacity of amplification by PCR. All samples were dissected 7 days after the blood meal.
6
RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples were homogenized in TRIzol reagent (Invitrogen) for total RNA extraction. Reverse transcription reaction was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using 1 μg of total RNA after RNase-free DNase I (Invitrogen) treatment, Multiscribe Reverse Transcriptase enzyme (2.5 U/μL) and random primers for 10 min at 25°C followed by 2 hours of incubation at 37°C. As a control for the DNAse treatment efficiency, we performed control reactions without the enzyme followed by testing the capacity of amplification by PCR.
7
RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples were homogenized in Trizol reagent (Invitrogen) for total RNA extraction. Reverse transcription reaction was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using 1 µg of total RNA after RNase-free DNase I (Invitrogen) treatment, Multiscribe Reverse Transcriptase enzyme (2.5 U/µL) and random primers for 10 min at 25°C followed by 2 h of incubation at 37°C. As a control for the DNAse treatment efficiency, we performed control reactions without the enzyme followed by testing the capacity of amplification by PCR.
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using either RNeasy Mini or Micro Kit together with the Qiashredder Kit (Qiagen, Hilden, Germany). An on-column DNAse treatment was included during the extraction. The following complementary DNA synthesis was performed using MultiScribe Reverse Transcriptase enzyme (Applied Biosystems, Foster City, CA) and random primers. Quantitative PCR was carried out in a 7300 Real-Time PCR (RT-PCR) System (Applied Biosystems) with SYBR Green PCR Master mix (Applied Biosystems). Comparative Ct method was used in order to quantify mRNA levels and three reference genes (SDHA, UBC, YWHAZ) were included to normalise gene-expression levels. Experiments were performed in triplicates. Primers are listed in Supporting information Table 2.
9
Automated RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was automatically extracted using the Arrow with Arrow RNA (Tissue Kit‐DNA Free) Kit (DiaSorin, Saluggia, Italy) and converted to cDNA using the MultiScribe Reverse Transcriptase Enzyme (Applied Biosystems, Foster City, CA) with random primers. Quantitative RT–PCR was performed with the SYBR Green PCR Master Mix (Life Technologies, Carlsbad, CA) using the comparative Ct method (Vandesompele et al, 2002 ). Three reference genes (YWHAZ, UBC, and SDHA) were used to normalize gene‐of‐interest expression. Primer sequences can be found in Appendix Table S3 .
10
Quantitative Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the RNeasy Mini Kit and the Qiashredder Kit (QIAGEN) according to manufacturer instructions, and cDNA synthesized using random primers and Multi-Scribe reverse transcriptase enzyme (Applied Biosystems). The amplifications were run using a QuantStudio 7 real-time PCR system (Applied Biosystems, Foster City, USA) with SYBR Green Master Mix (Applied Biosystems). Relative gene expression was normalized to the expression of three housekeeping genes (UBC, SDHA, and YWHAZ) using the comparative ΔΔCT method. Five independent experiments were performed, read in duplicate.
Primers:
Primers:
| FORWARD | REVERSE | |
|---|---|---|
| GCTGGTTGCCTCATGTTATTATGC | CCATGGAGGAAGGAAGAGGAGAGA | |
| GCCTGGGCGCCGAGTGGA | GGGCGAGCCGTTCATGTAGGTCTG | |
| AGCAAAACCCGGAGGAGT | CCACATCGGCCTGTGTATATC | |
| ATTTGGGTCGCGGTTCTT | TGCCTTGACATTCTCGATGGT | |
| TGGGAACAAGAGGGCATCTG | CCACCACTGCATCAAATTCATG | |
| ACTTTTGGTACATTGTGGCTTCAA | CCGCCAGGACAAACCAGTAT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!