Cfx96 real time pcr system machine

Cell pellets were stored in Trizol reagent and homogenized in fresh Trizol. Total RNA was isolated from cells using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Total RNA was quantified using the Nanodrop N-1000 by Agilent Biosystems (Santa Clara, CA, USA). cDNAs were synthesized from the isolated RNA using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.). Reverse transcription was performed by using random hexamers at 25 °C for 5 min, 42 °C for 30 min, and 85 °C for 5 min. Quantitative PCR was performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Inc.) in a CFX96 Real-Time PCR System machine (Bio-Rad Laboratories, Inc.). The data was analyzed using CFX96 Real-Time PCR System (Bio-Rad Laboratories, Inc.). Primer sequences for the genes were described in Table 1.Table 1

Primers for real-time polymerase chain reaction

Primer set	Forward primer (5′→3′)	Reverse primer (5′→3′)
NRG-1	tgatcgttgccaaaactacg	accaacagggcgatacagat
ErbB4	tgccataagtcttgcactgg	cgtagggtccatagcacctg
GAPDH	aacgaccccttcattgac	tccacgacatactcagcac

Cell pellets were stored in Trizol reagent and homogenized in fresh Trizol. Total RNA were isolated from cells using an RNeasy Mini Kit (Qiagen, Valencia, CA). Total RNA was quantified using the Nanodrop N-1000 byAgilent Biosystems (Santa Clara, CA). cDNA were synthesized from the isolated RNA using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc). Reverse transcription was performed by using random hexamers at 25 °C for 5 minutes, 42 °C for 30 minutes, and 85 °C for 5 minutes. Quantitative PCR were performed using iQ SYBR Green Supermix (Bio-Rad Laboratories, Inc.) in a CFX96 Real-Time PCR System machine (Bio-Rad Laboratories, Inc.). The data was analyzed using CFX96 Real-Time PCR System (Bio-Rad Laboratories, Inc). Primer sequences for the genes were described as previously and summarized in Table 1.