K48 ub

Manufactured by Cell Signaling Technology

K48-Ub is a ubiquitin protein that specifically recognizes and binds to proteins modified with K48-linked polyubiquitin chains. It is used as a tool in research to study the cellular processes involving K48-linked polyubiquitination.

Automatically generated - may contain errors

Lab products found in correlation

5 protocols using k48 ub

Immunoprecipitation and Immunoblotting Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoprecipitation and immunoblotting were carried out as described previously [46 (link)]. The following antibodies were used: IRF3 (1:1000, Santa Cruz, sc-9082), p-IRF3 (1:1000, Cell Signaling, 4947S), OTUD1 (1:1000, Abcam, ab182511), Flag (1:5000, Sigma, F7425), β-actin (1:5000, Proteintech, 66009-1-Ig), Myc (1:5000, Abmart, m2002), MAVS (1:1000, Santa Cruz, sc-166583), TRAF3 (1:1000, Cell Signaling, 4729S), TRAF6 (1:1000, Abcam, ab94720), TBK1 (1:1000, Cell Signaling, 3013S), RIG-I (1:1000, Cell Signaling, 4200S), Smurf1 (1:1000, Santa Cruz, sc-100616), Smurf2 (1:1000, Santa Cruz, sc-25511), Ub (1:1000, Santa Cruz, sc-8017), HA (1:5000, Abcam, ab9110), K48-Ub (1:1000, Cell Signaling, 4289S), and VSVG (1:5,000, Santa Cruz, sc-66180).

Zhang L., Liu J., Qian L., Feng Q., Wang X., Yuan Y., Zuo Y., Cheng Q., Miao Y., Guo T., Zheng X, & Zheng H. (2018). Induction of OTUD1 by RNA viruses potently inhibits innate immune responses by promoting degradation of the MAVS/TRAF3/TRAF6 signalosome. PLoS Pathogens, 14(5), e1007067.

+ Open protocol

+ Expand

Comprehensive Antibody and Reagent Catalog

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies against USP7 (Cat. CST#4833), K48Ub (Cat. CST#4289), and K63Ub (Cat. CST#12930) were purchased from Cell Signaling Technologies, Inc. The antibodies against RNF6 (Cat. #20437-1-AP), USP9x (Cat. #55054-1-AP), PARP (Cat. #13371-1-AP), Caspase 3 (Cat. #19677-1-AP), GAPDH (Cat. #60004-1-Ig), α-tubulin (Cat. #11224-1-AP), and V5 (Cat. #14440-1-AP) were obtained from Proteintech. The monoclonal antibodies including anti-Flag (Cat. #M185-3L), anti-HA (Cat. #M180-3), and anti-Myc (Cat. #M192-3) were obtained from Medical and Biological Laboratories Co Ltd. The anti-Ub antibody (Cat. #SL-8017) was purchased from Santa Cruz Biotechnology, Inc. HRP-labeled goat anti-mouse (Cat. #A0216) and goat anti-rabbit IgG (H + L) antibodies (Cat. #A0208) were purchased from Beyotime Institute of Biotechnology. MG132 (Cat. #S2619), Bortezomib (Cat. #S1013), and P5091 (Cat. #S7132) were purchased from Santa Cruz Biotechnology and Selleck Chemicals Inc, respectively. CHX (Cat. #C7698) and chloroquine (CHQ, Cat. #C6628) were purchased from Sigma-Aldrich. LBH589 (LBH, Cat. #M1748) was purchased from AbMole Bioscience Inc. Nilotinib (Cat. #IN0560) was purchased from Solarbio Life Science. Recombinant ubiquitin (Cat. #U100-H), UBE1 (Cat. #E-304), UBE2D1(Cat. #E2-616), and ATP (Cat. #B-20) were all purchased from Boston Biochem Inc.

Zhuang H., Ren Y., Mao C., Zhong Y., Zhang Z., Cao B., Zhang Y., Huang J., Xu G., Huang Z., Xu Y, & Mao X. (2022). Induction of zinc finger protein RNF6 auto-ubiquitination for the treatment of myeloma and chronic myeloid leukemia. The Journal of Biological Chemistry, 298(9), 102314.

+ Open protocol

+ Expand

Antibody Panel for Cellular Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used for IHC and Western immunoblotting: ATF4 (catalog 10835-1-AP) and SKP2 (catalog 15010-1-AP) from Proteintech; CHOP (catalog 2895), p-YAP (catalog 13008, S127), YAP (catalog 14074), p27 (catalog 3686), MYC (catalog 9402), p-RPS6 (catalog 4858, S235/236), t-RPS6 (catalog 2217), p-mTORC1 (catalog 5536, S2448), t-mTORC1 (catalog 2983), p-ERK1/2 (catalog 9101, T202/Y204), t-eIF2α (catalog 2103), p-AKT (catalog 9271, S473), t-AKT (catalog 4691), EIF4FBP1 (catalog 2855, T37/46), K48-Ub (catalog 8081), p-PERK (catalog 3179, T980), and PERK (catalog 3192) from Cell Signaling Technology; CYR61 (catalog E-AB-14920), CTGF (E-AB-12339), and aquaporin 2 (E-AB-30540) from Elabscience Biotechnology; CDK1 (catalog SC-54) and t-ERK1/2 (catalog SC-94) from Santa Cruz Biotechnology; α-tubulin (catalog T5168) and K63-Ub (catalog 05-1308) from MilliporeSigma; PCNA (catalog MS-106-P1ABX and, p-LATS1/2 (catalog PA5-64591, S809/S872) from Thermo Fisher Scientific; Oct4 (catalog NB100-2379) from Novus Biologicals; Sox2 (catalog ab97959), vimentin (catalog ab92547), Ki-67 (clone SP6), p-eIF2α (catalog ab32157, S51), BIM (catalog ab32158), and TAZ (catalog ab224239) from Abcam; GRP78 (catalog A0241) from StressMarq Biosciences; and nestin 1 (monoclonal rat-401s) from DSHBU Iowa.

Panda D.K., Bai X., Zhang Y., Stylianesis N.A., Koromilas A.E., Lipman M.L, & Karaplis A.C. (2022). SCF-SKP2 E3 ubiquitin ligase links mTORC1/ER stress/ISR with YAP activation in murine renal cystogenesis. The Journal of Clinical Investigation, 132(24), e153943.

+ Open protocol

+ Expand

Investigating Innate Immune Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

CpG-DNA refers to the phosphorothioate backbone containing oligonucleotide 1668 (TCCATGACGTTCCTGATGCT) (TIB Molbiol). Other agonists used were LPS (Escherichia coli 0127:B8) (Sigma-Aldrich), CM (Sigma-Aldrich), and R848 (InvivoGen). Antibodies were sourced as follows: SPOP (ProteinTech); FLAG-M2 (Sigma-Aldrich); MyD88, IκBα, P-p38, P-p65, P-JNK, P-ERK, p38, IRF5, IRF1, IRF8, CSK, P-SFKs (Y416), LYN, P-Tyr¹⁰⁰⁰, and K48-Ub (Cell Signaling Technology); hemagglutinin (HA) (3F10) (Sigma-Aldrich); IRF3, IRF7, p65, and USF2 (Santa Cruz Biotechnology); and secondary antibodies conjugated to horseradish peroxidase (HRP) [Amersham ECL Rabbit IgG, HRP-linked F(ab′)₂ fragment from donkey and Amersham ECL Mouse IgG, HRP-linked F(ab’)₂ fragment from sheep] (Cytiva). Chemiluminescent substrate was from Bio-Rad. Beads for IP were from Sigma-Aldrich (FLAG-M2 resin and anti-HA affinity matrix, clone 3F10), IBA Lifesciences (strep-XT beads), and Cell Signaling Technology (P-Tyr¹⁰⁰⁰ sepharose beads and protein A agarose beads). Enzyme-linked immunosorbent assay (ELISA) kits were from eBioscience (TNF-α and IL-6) and R&D Systems (IL-12p40 and IFN-β). Luciferase assay system was from Promega. Lipofectamine 2000 was from Thermo Fisher Scientific. MG-132 and cycloheximide were from Sigma-Aldrich. Recombinant LYNa protein was from Carna Biosciences.

Tawaratsumida K., Redecke V., Wu R., Kuriakose J., Bouchard J.J., Mittag T., Lohman B.K., Mishra A., High A.A, & Häcker H. (2022). A phospho-tyrosine–based signaling module using SPOP, CSK, and LYN controls TLR-induced IRF activity. Science Advances, 8(27), eabq0084.

+ Open protocol

+ Expand

Antibodies and Plasmids for HERC4 and MafA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rabbit anti-HERC4 and Rabbit anti-MafA antibodies were obtained from Bethyl Laboratories. Mouse anti-HA, anti-Myc, anti-Flag, and anti-GAPDH antibodies were obtained from Medical & Biological Laboratories Co Ltd. Anti-phosphoserine/threonine/tyrosine antibody was purchased from Abcam. Antibodies against GSK3β, c-Maf, and GFP were obtained from Santa Cruz Biotechnology. Antibodies against LAMIN B, HSP90, p-STAT3, STAT3, Bcl-2, Mcl-1, CCND2, K48-Ub, and K63-Ub were purchased from Cell Signaling Technologies. The HERC4 plasmid was subcloned into a pcDNA3.1 vector carrying a Flag or Myc tag (11 (link)). The HA-Ub, HA-Ub-K48, HA-Ub-K48R, HA-Ub-K63, and HA-Ub-K63R plasmids were constructed in-house (27 ). The human MafA gene was cloned from genomic DNA of HeLa cells as described previously (11 (link)).

Zhang Z., Li M., Lin P., Ren Y., He Y., Wang S., Xu Y., Cao B., Wang G., Moran M.F, & Mao X. (2023). The ubiquitin ligase HERC4 suppresses MafA transcriptional activity triggered by GSK3β in myeloma by atypical K63-linked polyubiquitination. The Journal of Biological Chemistry, 299(5), 104675.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!